Entry information : HsubCIIBB02
Entry ID 10565
Creation 2012-02-28 (Christophe Dunand)
Last sequence changes 2012-02-28 (Christophe Dunand)
Sequence status complete
Reviewer Catherine
Last annotation changes 2019-05-10 (Catherine )
Peroxidase information: HsubCIIBB02
Name HsubCIIBB02
Class Other class II peroxidase type B    [Orthogroup: CIIBB002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Strophariaceae Hypholoma
Organism Hypholoma sublateritium    [TaxId: 71945 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HsubCIIBB02
start..stop
S start..stop
HsubCIIBB03 720 0 1..370 1..370
HsubCIIBB10 720 0 1..370 1..370
HsubCIIBB09 679 0 1..370 1..370
HsubCIIBB05 607 0 1..366 1..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 49455..49515 61 N° 2 49218..49404 187 N° 3 49017..49157 141 N° 4 48713..48958 246
N° 5 48630..48664 35 N° 6 48531..48579 49 N° 7 48403..48472 70 N° 8 48304..48349 46
N° 9 48171..48247 77 N° 10 48012..48110 99 N° 11 47894..47958 65 N° 12 47802..47838 37
complement(join(47802..47838,47894..47958,48012..48110,48171..48247,48304..48349 ,48403..48472,48531..48579,48630..48664,48713..48958,49017..49157,49218..49404,4 9455..49515))


exon

Literature and cross-references HsubCIIBB02
DNA ref. JGI genome:   scaffold_107 (49515..47802)
Cluster/Prediction ref. JGI gene:   47480
Protein sequence: HsubCIIBB02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   371 (349)
PWM (Da):   %s   38410.32 (36208.1)  
PI (pH):   %s   4.25 (4.29) Peptide Signal:   %s   cut: 22 range:22-370
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVFSAALSAFVLALPLLSVNAARTKRALCPDGKNTAVNKACCALFPVVDDIVDNLFTNECGDSAHGALRLVFHDAIGISPTVGGGGADGSIATFNETELTFPANLGIDDVLDDIGPFILKHANTVSPGDFIQLAGAVSLVQCPGAPRIPFFMGRALPKAASPPNLVPQPTDDITTILERFGSVGFSPAEVVAVVGGSHSVAGADDVVPNFQGIPFDQTPSQFTQIFVDVLLHGTNFTDGGGPQSGELETAVAGTVRLQSDGLARDPRTACTWQSFVNEQSKMAAAFGAGVLKLSFLGQNERLTDCSEVIPAAKAVNFGPATFPPTKSIRDIDLSCDEARFPDLRTQPGPAVTIAPIPQAVTSSGDDS

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCAGCGCTGCCCTCTCCGCATTTGTGCTCGCACTGCCCCTTCTCTCGGTAAATGGTAAGGGCAACGCTTTCATCTTGGAGGAGTGTTCTCATCATTATTTCCAGCTGCCAGGA
CCAAGCGCGCTTTGTGCCCCGACGGTAAAAACACCGCAGTCAACAAGGCGTGCTGTGCCCTGTTCCCTGTCGTCGATGACATAGTGGACAACCTTTTCACCAACGAATGTGGTGACTCGG
CCCACGGTGCTCTCCGTCTGGTTTTCCACGACGCCATTGGTATTTCCCCGACGGTCGG
GTTCGTCTAATCATAAATCTGGCGTCGCATCAGTAATATGCTAATCCTTAAATACCATAGCG
GTGGAGGTGCTGATGGATCCATCGCAACCTTCAACGAGACGGAATTGACCTTCCCTGCCAACCTTGGCATCGACGATGTTCTCGACGACATTGGCCCGTTCATTCTTAAGCACGCCAACA
CCGTCTCTCCTGGAGACTT
GTAAGTAACAAATTTATTATTTGAACCACAGCTTCCGTTAACAGTGTCTCCATTGCAGCATCCAGCTCGCTGGAGCCGTGAGTCTGGTCCAGTGCCCGGGT
GCTCCCCGCATTCCGTTCTTCATGGGACGTGCCCTACCCAAGGCCGCATCGCCGCCCAACCTCGTTCCTCAGCCAACTGACGACATCACCACCATCCTTGAGCGCTTCGGTTCAGTCGGT
TTCTCCCCCGCCGAGGTCGTCGCCGTTGTCGGCGGATCTCACAGTGTCGCCGGTGCTGACGACGTTGTTCCGAACTTCCAGGG
GTACGCCAGCCCTTATTTTCTATTTCGATCTTACTGA
CCTTCTTCAAGAATCCCCTTCGATCAAACGCCCTCTCAGTTTGACAGTATGTCTATTTCTGTACTCGCCTCGATATTTTGCTAACATATCGTTTAGCTCAGATCTTCGTTGACGTTCTCC
TGCACGGAACCAACTTCACTGACGG
GTATGCATTGATATTATTGCTGCGGTCTGGATTTCTACTAAATCTGACATACCTGCAGAGGAGGCCCCCAGTCCGGCGAACTCGAGACTGCTGTT
GCCGGCACGGTACGCTTGCAGTCAGACGGACTT
GTAAGTTATTCAGATGATATTTCACGATAACTTTGCTGATCACATATGTACAGCTCGCCCGTGACCCAAGGACCGCCTGCACATGGC
AATCTTTCGTCA
GTAAGTAGCAACTCCATCTTTTCTAGGACACGAACCTCATATAGCATGTATTACAGACGAGCAGTCCAAGATGGCCGCGGCCTTCGGAGCCGGCGTGCTCAAGCTTTC
CTTCTTGGGCCAGAATGAGCGCGAG
GTAATCAATAAGCTGCATATTTCCAATATCCCAGCGCTAATATCCGCGATGTGCCTTTAGTTGACCGACTGCAGTGAAGTAATCCCTGCGGCCAA
GGCCGTCAACTTTGGACCCGCTACTTTCCCACCTACCAAGAGCATCCGCGATATCGACCTCTCT
GTGAGCTACACTTTTATACGGTATATACCTGAATTCTCACAAGTGTTCGATAGTGC
GACGAGGCCAGGTTCCCCGACCTCCGCACTCAGCCAGGCCCGGCGGTTACCATCGCTCCCAT
GTGCGTCGACTCATAATCCCTATTTATGCATTGATTTCTGACCTGTATCCTTTAGTCC
CCAAGCTGTTACCAGCAGCGGCGACGACTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCAGCGCTGCCCTCTCCGCATTTGTGCTCGCACTGCCCCTTCTCTCGGTAAATGCTGCCAGGACCAAGCGCGCTTTGTGCCCCGACGGTAAAAACACCGCAGTCAACAAGGCG
TGCTGTGCCCTGTTCCCTGTCGTCGATGACATAGTGGACAACCTTTTCACCAACGAATGTGGTGACTCGGCCCACGGTGCTCTCCGTCTGGTTTTCCACGACGCCATTGGTATTTCCCCG
ACGGTCGG
CGGTGGAGGTGCTGATGGATCCATCGCAACCTTCAACGAGACGGAATTGACCTTCCCTGCCAACCTTGGCATCGACGATGTTCTCGACGACATTGGCCCGTTCATTCTTAAG
CACGCCAACACCGTCTCTCCTGGAGACTT
CATCCAGCTCGCTGGAGCCGTGAGTCTGGTCCAGTGCCCGGGTGCTCCCCGCATTCCGTTCTTCATGGGACGTGCCCTACCCAAGGCCGCA
TCGCCGCCCAACCTCGTTCCTCAGCCAACTGACGACATCACCACCATCCTTGAGCGCTTCGGTTCAGTCGGTTTCTCCCCCGCCGAGGTCGTCGCCGTTGTCGGCGGATCTCACAGTGTC
GCCGGTGCTGACGACGTTGTTCCGAACTTCCAGGG
AATCCCCTTCGATCAAACGCCCTCTCAGTTTGACACTCAGATCTTCGTTGACGTTCTCCTGCACGGAACCAACTTCACTGACGGA
GGAGGCCCCCAGTCCGGCGAACTCGAGACTGCTGTTGCCGGCACGGTACGCTTGCAGTCAGACGGACTT
CTCGCCCGTGACCCAAGGACCGCCTGCACATGGCAATCTTTCGTCAACGAG
CAGTCCAAGATGGCCGCGGCCTTCGGAGCCGGCGTGCTCAAGCTTTCCTTCTTGGGCCAGAATGAGCGCGAG
TTGACCGACTGCAGTGAAGTAATCCCTGCGGCCAAGGCCGTCAACTTT
GGACCCGCTACTTTCCCACCTACCAAGAGCATCCGCGATATCGACCTCTCT
TGCGACGAGGCCAGGTTCCCCGACCTCCGCACTCAGCCAGGCCCGGCGGTTACCATCGCTCCCATTCCC
CAAGCTGTTACCAGCAGCGGCGACGACTCTTAA

Retrieve as FASTA