Entry information : HsubCIIBB09
Entry ID 10566
Creation 2012-02-28 (Christophe Dunand)
Last sequence changes 2012-02-28 (Christophe Dunand)
Sequence status complete
Reviewer Catherine
Last annotation changes 2019-05-10 (Catherine )
Peroxidase information: HsubCIIBB09
Name HsubCIIBB09
Class Other class II peroxidase type B    [Orthogroup: CIIBB002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Strophariaceae Hypholoma
Organism Hypholoma sublateritium    [TaxId: 71945 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HsubCIIBB09
start..stop
S start..stop
HsubCIIBB03 684 0 1..370 1..370
HsubCIIBB10 682 0 1..370 1..370
HsubCIIBB02 679 0 1..370 1..370
HsubCIIBB05 617 0 1..366 1..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 56434..56494 61 N° 2 56548..56734 187 N° 3 56797..56937 141 N° 4 56992..57237 246
N° 5 57290..57324 35 N° 6 57376..57424 49 N° 7 57483..57552 70 N° 8 57606..57651 46
N° 9 57708..57784 77 N° 10 57845..57943 99 N° 11 57996..58060 65 N° 12 58114..58150 37
join(56434..56494,56548..56734,56797..56937,56992..57237,57290..57324,57376..574 24,57483..57552,57606..57651,57708..57784,57845..57943,57996..58060,58114..58150 )


exon

Literature and cross-references HsubCIIBB09
DNA ref. JGI genome:   scaffold_107 (56434..58150)
Cluster/Prediction ref. JGI gene:   47481
Protein sequence: HsubCIIBB09
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   371 (349)
PWM (Da):   %s   38340.18 (36138.0)  
PI (pH):   %s   4.31 (4.31) Peptide Signal:   %s   cut: 22 range:22-370
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVFSSALSAFVLALPLLAVNAARTKRSLCPDGKNTAVNKACCALFPVVDDIVDNLFTNECGDSAHGALRLVFHDAIGISPTAGGGGADGSIATFNATELTFPANLGIDDILDDLGPFLLKHAATVSPGDFIQLAGAVSLVQCPGAPRIPFFSGRAQPKAASPPNLVPQPTDDVTSILERFASVGFSPAEVVAVVGGSHSVAGADDIVPNFQGIPFDQTPSQFTQIFVDVLLHGTNFTDNGGPQSGESETAVAGTVRLQSDGLARDPRTACTWQSFVNEQSKMAEAFGAAVLKLSFLGQNQHLTDCSEVIPQAIPVNFGPATFPPTKSIKDIDESCNTAKFPDLRTQPGPATTIAPIPQAESTSGSSS

Retrieve as FASTA  
Remarks complete sequence from genomic (11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCAGCAGTGCACTTTCCGCATTTGTGCTCGCATTGCCTCTTCTCGCTGTCAATGGTAAGCCCAGTGCGTCACTGTCTGAAAAGGAAGACGCTCATTATTATTTCCAGCTGCCA
GGACCAAGCGCTCTTTGTGCCCCGACGGTAAAAACACCGCAGTCAACAAGGCGTGCTGTGCCCTGTTCCCTGTTGTCGATGACATTGTAGACAACCTTTTCACCAACGAATGTGGTGACT
CGGCCCACGGTGCTCTCCGTCTGGTTTTCCACGACGCTATTGGTATTTCTCCCACGGCCGG
GTTCGTCTAAACATATATCTGACACGCCATGAACCATGCTAATTCCTAAAATTAATGAA
CAGTGGCGGAGGTGCTGACGGCTCAATTGCGACCTTTAACGCGACGGAACTGACCTTCCCTGCCAACCTTGGTATCGATGATATTCTCGATGACCTCGGCCCGTTCCTCCTCAAGCATGC
GGCAACCGTCTCTCCAGGAGACTT
GTGAGTTGGACAGGTAGCAGTCCTTCGTTCTCTGCTCACAGTACCCAATTGTAGCATTCAGCTCGCTGGAGCCGTGAGTTTGGTTCAGTGCCCAGG
GGCTCCTCGCATTCCGTTCTTCTCGGGTCGCGCTCAACCGAAGGCAGCATCGCCTCCCAACCTTGTTCCTCAACCAACCGACGACGTCACCAGCATCCTTGAGCGTTTCGCGTCCGTCGG
CTTCTCTCCTGCCGAGGTCGTTGCTGTTGTTGGTGGATCCCACAGTGTCGCAGGTGCCGACGACATTGTTCCCAACTTCCAAGG
GTACGCTCTATTACCATATACCCATTTCGGAATGCT
GCTAACCTTCACGAAGAATTCCTTTCGATCAAACTCCTTCTCAATTTGACAGTATGTCTTTCGCATCCCGAGTAGTAAGCCACCTACTAACAGATTTTTTAGCTCAGATCTTCGTTGATG
TGCTCCTCCATGGCACCAACTTCACTGACAA
GTATGCATCATATGATTGTTGCAATGCGAATTTATACTTAATTATATTAAACCTGCAGCGGAGGTCCCCAGTCCGGCGAATCCGAGACT
GCTGTTGCAGGCACTGTGCGCTTACAGTCAGACGGACTG
GTAAGCGATTCGGACGGCATTGAGCAACAATTGTACTGACTGTTTTTGTATAGCTTGCCCGTGACCCAAGAACCGCCTGCA
CATGGCAGTCCTTCGTCA
GTAAGTGGTGGTCACATACCCTTCAAAAGATCAAACTAACGACGTATATAATACAGACGAGCAATCCAAGATGGCCGAAGCCTTTGGCGCTGCAGTGCTCAA
GCTCTCCTTTTTGGGTCAGAACCAGCACGAG
GTAGGCATTCTTTTCCTGAGATATAACTCAGCGCTAATCCCTCCGTGCTATATTCTTTAGTTGACTGACTGCAGTGAAGTCATCCCCCA
GGCCATACCCGTCAACTTTGGGCCAGCAACTTTCCCTCCCACTAAGAGCATCAAAGACATCGATGAATCT
GTAAATATATTATTTCTGTGGTCTATTAGATATCAGTGCTCACATATATC
AGTGCAACACTGCCAAATTCCCTGACCTCCGCACTCAGCCAGGCCCAGCCACCACTATCGCACCTATGTTTGTCGATTTAAATTATATATGTGTGTATCACTTCTAACCAACCCTTTCAG

TCCTCAAGCTGAAAGCACCAGCGGATCCTCTTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCAGCAGTGCACTTTCCGCATTTGTGCTCGCATTGCCTCTTCTCGCTGTCAATGCTGCCAGGACCAAGCGCTCTTTGTGCCCCGACGGTAAAAACACCGCAGTCAACAAGGCG
TGCTGTGCCCTGTTCCCTGTTGTCGATGACATTGTAGACAACCTTTTCACCAACGAATGTGGTGACTCGGCCCACGGTGCTCTCCGTCTGGTTTTCCACGACGCTATTGGTATTTCTCCC
ACGGCCGG
TGGCGGAGGTGCTGACGGCTCAATTGCGACCTTTAACGCGACGGAACTGACCTTCCCTGCCAACCTTGGTATCGATGATATTCTCGATGACCTCGGCCCGTTCCTCCTCAAG
CATGCGGCAACCGTCTCTCCAGGAGACTT
CATTCAGCTCGCTGGAGCCGTGAGTTTGGTTCAGTGCCCAGGGGCTCCTCGCATTCCGTTCTTCTCGGGTCGCGCTCAACCGAAGGCAGCA
TCGCCTCCCAACCTTGTTCCTCAACCAACCGACGACGTCACCAGCATCCTTGAGCGTTTCGCGTCCGTCGGCTTCTCTCCTGCCGAGGTCGTTGCTGTTGTTGGTGGATCCCACAGTGTC
GCAGGTGCCGACGACATTGTTCCCAACTTCCAAGG
AATTCCTTTCGATCAAACTCCTTCTCAATTTGACACTCAGATCTTCGTTGATGTGCTCCTCCATGGCACCAACTTCACTGACAAC
GGAGGTCCCCAGTCCGGCGAATCCGAGACTGCTGTTGCAGGCACTGTGCGCTTACAGTCAGACGGACTG
CTTGCCCGTGACCCAAGAACCGCCTGCACATGGCAGTCCTTCGTCAACGAG
CAATCCAAGATGGCCGAAGCCTTTGGCGCTGCAGTGCTCAAGCTCTCCTTTTTGGGTCAGAACCAGCACGAG
TTGACTGACTGCAGTGAAGTCATCCCCCAGGCCATACCCGTCAACTTT
GGGCCAGCAACTTTCCCTCCCACTAAGAGCATCAAAGACATCGATGAATCT
TGCAACACTGCCAAATTCCCTGACCTCCGCACTCAGCCAGGCCCAGCCACCACTATCGCACCTATTCCT
CAAGCTGAAAGCACCAGCGGATCCTCTTCTTAA

Retrieve as FASTA