Entry information : HanAPx-CcP02 (hpox2 / HanAPx-CcP02)
Entry ID 10570
Creation 2012-02-28 (Christophe Dunand)
Last sequence changes 2012-02-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-23 (Catherine Mathe (Scipio))
Peroxidase information: HanAPx-CcP02 (hpox2 / HanAPx-CcP02)
Name (synonym) HanAPx-CcP02 (hpox2 / HanAPx-CcP02)
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Bondarzewiaceae Heterobasidion
Organism Heterobasidion annosum (root rot fungus)    [TaxId: 13563 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HanAPx-CcP02
start..stop
S start..stop
HanAPx-CcP01 779 0 1..536 2..536
HanAPx-CcP03 650 0 19..536 23..537
HC14APx-CcP03 394 4e-132 7..536 13..550
HC14APx-CcP02 386 4e-129 7..514 9..518
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 252390..252610 221 N° 2 252170..252324 155 N° 3 251780..252110 331 N° 4 251418..251715 298
N° 5 251317..251363 47 N° 6 250974..251265 292 N° 7 250624..250890 267  
complement(join(250624..250890,250974..251265,251317..251363,251418..251715,2517 80..252110,252170..252324,252390..252610))


exon

Literature and cross-references HanAPx-CcP02 (hpox2 / HanAPx-CcP02)
DNA ref. JGI genome:   scaffold_05 (252610..250624)
Cluster/Prediction ref. JGI gene:   383689
Protein sequence: HanAPx-CcP02 (hpox2 / HanAPx-CcP02)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   537 (517)
PWM (Da):   %s   56557.91 (54534.9)  
PI (pH):   %s   4.26 (4.23) Peptide Signal:   %s   cut: 20 range:20-536
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRGTASLATFLSLSLLSNGYQWPSDPVFEALEEMYTLSDGLGSSGFVGGIEPCSFSPANNRTSGRQAAAEWVRTAYHDMATADVAAGTGGLDASISFETDRAENVGDAFNASFGFFVGFQNARVMSDLIALGAVYAVRVCSGPIIPFRAGRIDATEAGPKGVPEPQQDLASHTASFAKQGFNVSEMIGLVACGHTLGGVHEEDFPTIVYGETNSDNNTSGMQHFDDSFDEFDNRVAVQWVNSSLSTNALATGFNSTTNSDGRIFAADGNATMRDLASSNTLFQSRCAELLARMIDTVPKGVQLTDVITPIAIKPWNVQLSINDNGQLHLGGYVLFTSNKSASTSDYEVNVTWTDHNGAACEGCSTTTSAQGFPGTIFSGTVMMFNFDTTIDPKVGFSAFSVEYTSTPGGPVTKADNGGAGFPFSDVVMLQSSASCTSDGTIKAVAVRNDQPITAVYIDYTSAETQPGTVMLKMVPSSINMTASSNSSASSLYTLYNAEFKVDNAGSSSFNIFAEVGGKVYTDDFKRPNGLNSC*

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGGGGCACAGCGTCTCTCGCCACTTTCCTATCTCTTTCACTCCTCTCGAACGGATATCAATGGCCCAGTGATCCCGTCTTTGAGGCCCTTGAGGAGATGTACACCCTGAGCGATGGC
CTGGGCTCGTCTGGTTTCGTTGGAGGCATTGAACCGTGCAGCTTTTCGCCGGCGAATAATCGCACAAGCGGAAGGCAGGCTGCCGCCGAGTGGGTTCGAAC
GTGAGCTACAGTATCCCGT
GGGTGATCGCAGTGAGCTGACCAGTCGGTTGCCCTCGGGCGTGTAGGGCATACCACGATATGGCCACGGCGGATGTTGCAGCTGGCACCGGTGGGCTCGACGCGTCGATCAGCTTCGAGA
CCGATCGCGCGGAGAATGTAGGCGACGCATTCAACGCCAGTTTCGGTTTCTTCGTCGGCTTCCAGAATGCCCGCGTCTCCA
GTGAGTTCCTTGTTTGCTGGCGAAAGAAGAACGCAGGGA
TTGATCTCGATGCACTCTAGTGTCCGACCTCATTGCCCTCGGTGCGGTCTACGCCGTTCGTGTTTGTTCCGGCCCCATAATTCCCTTCCGCGCTGGTCGCATTGACGCTACGGAAGCTGG
CCCCAAGGGAGTTCCCGAGCCGCAACAGGATCTCGCATCGCACACCGCGTCGTTCGCGAAACAGGGCTTCAACGTGAGCGAGATGATCGGTCTCGTGGCGTGCGGGCACACGCTTGGTGG
CGTCCACGAAGAGGACTTCCCCACGATCGTGTATGGAGAGACGAACTCGGACAACAACACGAGCGGGATGCAGCACTTCGACGACTCATTCGACGAGTTTGACAACCGCGT
GTGCGTGGG
TTCTTCCATTGAGGCCACATGCCTGAGATGCTGATAGGCGTTTACTCCCCGATAGCGCTGTGCAATGGGTGAACAGCAGCTTATCTACCAACGCGCTCGCGACTGGCTTTAACAGCACGA
CCAACTCCGACGGGCGAATCTTCGCCGCCGACGGCAACGCTACCATGCGTGACCTCGCCTCCAGCAACACCCTCTTCCAAAGCCGCTGTGCCGAGCTTCTTGCACGGATGATCGACACCG
TCCCGAAGGGCGTCCAGCTGACAGACGTCATCACTCCTATAGCCATCAAGCCTTGGAACGTCCAATTGAGCATCAACGACAACGGGCAGCTGCATCTCGGGGGCTATGTCCGC
GTACGTG
TATTCCTTTGCCGTCGAGGATGGCTTTTGACTGACGCATCTATGCAGTTATTCACTTCCAACAAATCTGCGTCCACTTCCGACTACGAGGTCAAGTGAGTCGTTTGCACCGATGTCGTCG
CTGAAGTCCTGATTTTCTATTGCAGCGTCACCTGGACCGATCACAACGGCGCTGCTTGTGAGGGGTGCAGCACAACCACGAGCGCACAAGGGTTCCCGGGCACTATCTTCTCGGGCACGG
TCATGATGTTCAACTTTGACACCACCATCGACCCCAAGGTCGGGTTCTCCGCCTTCAGCGTCGAGTACACGAGCACGCCGGGGGGGCCCGTGACCAAGGCCGACAACGGCGGTGCCGGCT
TCCCTTTTAGCGACGTCGTCATGCTGCAGTCGTCAGCATCCTGCACTTCCGACGGCACGATCAAAGCTGTCGCCGCG
GTACGTCCTTTCTCTTCTCTTCTCTTCTCTTTTAGGCTTGTCC
TTATGTGTGTGTGCTCATCGTCGATCGTTCTCTCGACCAGGTTCGCAACGACCAGCCCATCACGGCAGTCTACATCGACTATACCTCCGCCGAGACGCAGCCCGGAACTGTCATGCTTAA
GATGGTCCCGTCCTCCATCAACATGACGGCGAGCAGCAACTCTTCCGCGTCGAGCCTGTACACCCTGTACAACGCCGAGTTCAAGGTGGACAATGCGGGGAGCTCCTCGTTCAACATCTT
CGCCGAGGTGGGAGGGAAGGTCTATACTGATGACTTCAAGCGGCCGAACGGGCTTAACAGCTGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGGGGCACAGCGTCTCTCGCCACTTTCCTATCTCTTTCACTCCTCTCGAACGGATATCAATGGCCCAGTGATCCCGTCTTTGAGGCCCTTGAGGAGATGTACACCCTGAGCGATGGC
CTGGGCTCGTCTGGTTTCGTTGGAGGCATTGAACCGTGCAGCTTTTCGCCGGCGAATAATCGCACAAGCGGAAGGCAGGCTGCCGCCGAGTGGGTTCGAAC
GGCATACCACGATATGGCC
ACGGCGGATGTTGCAGCTGGCACCGGTGGGCTCGACGCGTCGATCAGCTTCGAGACCGATCGCGCGGAGAATGTAGGCGACGCATTCAACGCCAGTTTCGGTTTCTTCGTCGGCTTCCAG
AATGCCCGCGTCTCCA
TGTCCGACCTCATTGCCCTCGGTGCGGTCTACGCCGTTCGTGTTTGTTCCGGCCCCATAATTCCCTTCCGCGCTGGTCGCATTGACGCTACGGAAGCTGGCCCC
AAGGGAGTTCCCGAGCCGCAACAGGATCTCGCATCGCACACCGCGTCGTTCGCGAAACAGGGCTTCAACGTGAGCGAGATGATCGGTCTCGTGGCGTGCGGGCACACGCTTGGTGGCGTC
CACGAAGAGGACTTCCCCACGATCGTGTATGGAGAGACGAACTCGGACAACAACACGAGCGGGATGCAGCACTTCGACGACTCATTCGACGAGTTTGACAACCGCGT
CGCTGTGCAATGG
GTGAACAGCAGCTTATCTACCAACGCGCTCGCGACTGGCTTTAACAGCACGACCAACTCCGACGGGCGAATCTTCGCCGCCGACGGCAACGCTACCATGCGTGACCTCGCCTCCAGCAAC
ACCCTCTTCCAAAGCCGCTGTGCCGAGCTTCTTGCACGGATGATCGACACCGTCCCGAAGGGCGTCCAGCTGACAGACGTCATCACTCCTATAGCCATCAAGCCTTGGAACGTCCAATTG
AGCATCAACGACAACGGGCAGCTGCATCTCGGGGGCTATGTCCGC
TTATTCACTTCCAACAAATCTGCGTCCACTTCCGACTACGAGGTCAACGTCACCTGGACCGATCACAACGGCGCT
GCTTGTGAGGGGTGCAGCACAACCACGAGCGCACAAGGGTTCCCGGGCACTATCTTCTCGGGCACGGTCATGATGTTCAACTTTGACACCACCATCGACCCCAAGGTCGGGTTCTCCGCC
TTCAGCGTCGAGTACACGAGCACGCCGGGGGGGCCCGTGACCAAGGCCGACAACGGCGGTGCCGGCTTCCCTTTTAGCGACGTCGTCATGCTGCAGTCGTCAGCATCCTGCACTTCCGAC
GGCACGATCAAAGCTGTCGCCGCG
GTTCGCAACGACCAGCCCATCACGGCAGTCTACATCGACTATACCTCCGCCGAGACGCAGCCCGGAACTGTCATGCTTAAGATGGTCCCGTCCTCC
ATCAACATGACGGCGAGCAGCAACTCTTCCGCGTCGAGCCTGTACACCCTGTACAACGCCGAGTTCAAGGTGGACAATGCGGGGAGCTCCTCGTTCAACATCTTCGCCGAGGTGGGAGGG
AAGGTCTATACTGATGACTTCAAGCGGCCGAACGGGCTTAACAGCTGCTAG

Retrieve as FASTA