Entry information : HanAPx-CcP01 (hpox7 / HanAPx-CcP01)
Entry ID 10572
Creation 2012-02-28 (Christophe Dunand)
Last sequence changes 2012-02-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-23 (Catherine Mathe (Scipio))
Peroxidase information: HanAPx-CcP01 (hpox7 / HanAPx-CcP01)
Name (synonym) HanAPx-CcP01 (hpox7 / HanAPx-CcP01)
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Bondarzewiaceae Heterobasidion
Organism Heterobasidion annosum (root rot fungus)    [TaxId: 13563 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HanAPx-CcP01
start..stop
S start..stop
HanAPx-CcP02 769 0 2..536 1..536
HanAPx-CcP03 632 0 19..536 22..537
HC14APx-CcP03 367 1e-121 21..536 26..550
HEC38APx-CcP02 363 6e-120 24..536 30..551
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 468375..468595 221 N° 2 468656..468810 155 N° 3 468871..469201 331 N° 4 469270..469567 298
N° 5 469625..469671 47 N° 6 469727..470021 295 N° 7 470087..470350 264  
join(468375..468595,468656..468810,468871..469201,469270..469567,469625..469671, 469727..470021,470087..470350)


exon

Literature and cross-references HanAPx-CcP01 (hpox7 / HanAPx-CcP01)
DNA ref. JGI genome:   scaffold_02 (468375..470350)
Cluster/Prediction ref. JGI gene:   168564
Protein sequence: HanAPx-CcP01 (hpox7 / HanAPx-CcP01)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   537 (516)
PWM (Da):   %s   56945.67 (54820.5)  
PI (pH):   %s   4.83 (4.82) Peptide Signal:   %s   cut: 21 range:21-536
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MIRGVASLVIPLSISLLSDGYQRPDTVYDALEDLYTVNSGLGSSNFIAGVSPCSFAPANTRTTGRQAAAEWVRTAYHDMATADVEAGTGGIDASITFETDRAENVGDAFNASFNFFVGFQNKRVMSDLIALGTVYAVRACSGPSISYRAGRIDATGPGSKGVPEPQGDLATHTASFAKQGFNVSEMIGLVACGHTLGGVHEQDFSTIVQGETNADNNTSGMQHFDDSFDSFDNHIAVQWMNSSTSTNTLATGFNTTTNSDARIFAADGNATMRDLASNNQVFQDRCAYLLSRMIHTVPKGVQLTDVITPIPVKPWLAQLSIDNNGKLQFEGYIIFSTNKSQSPRDYAVNMTWTDHNGAACDGCSATARFPGLFSGSFWGAVALFHFNITIDPSVGFSAFSVEYTNTPGGPLTKADNDGAGFPFDDVAVLHKSASCIANDGSVKAVVIRNDQKIMSAYIIATSAVKQAGSIARKLSTAFVNVTESGPSLSSLYTLYSAEFNVGLVENASFDLVVETGGKTHITDFVRPNGFQSC*

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATACGGGGTGTAGCAAGCCTTGTCATCCCGCTATCTATTTCACTCCTTTCAGACGGATACCAAAGGCCAGATACTGTCTACGACGCTCTCGAGGATTTGTACACGGTGAACAGCGGA
CTGGGTTCCAGCAATTTCATTGCAGGGGTTTCACCATGCAGTTTCGCTCCGGCTAATACCAGGACTACTGGCAGGCAAGCTGCTGCTGAGTGGGTCCGCAC
GTGAGTACCACTATACTCC
CGATGAAGTTGATGATTTAAATCGAGGACGGCGGCCTATAGTGCGTACCATGATATGGCTACGGCAGATGTGGAAGCTGGCACTGGTGGAATTGATGCCTCTATCACTTTTGAGACCGAT
CGCGCAGAAAATGTCGGTGATGCTTTCAACGCCAGCTTCAATTTCTTTGTCGGGTTCCAAAACAAGCGTGTATCCA
GTAAGTTTGATTTATTTTTACACGCGTTACCTGTTATCTGCTCA
TTGATCAAATTCTTAGTGTCTGACCTCATCGCACTCGGAACTGTTTATGCTGTCCGTGCATGCTCAGGGCCTTCCATATCTTACCGGGCCGGTCGTATCGATGCCACAGGGCCTGGTTCT
AAGGGCGTCCCTGAGCCCCAAGGAGATCTTGCAACGCATACTGCTTCGTTCGCGAAACAAGGCTTTAATGTGAGCGAGATGATTGGTCTCGTGGCATGTGGACACACTCTAGGTGGTGTC
CACGAGCAAGATTTTTCTACAATTGTGCAGGGAGAGACGAATGCAGATAACAACACGAGTGGAATGCAACATTTCGACGACTCTTTTGACTCTTTCGACAACCACAT
GTGCGGCTTCTCC
TCTTCTGCATTCTGCCTATCCTAAAATATCCTGATATTCAATCATTTGTTGATAGCGCTGTACAATGGATGAACAGTAGTACTTCTACCAATACACTGGCGACTGGCTTCAATACCACGA
CAAACTCGGATGCGCGTATATTTGCTGCCGACGGCAATGCCACCATGCGCGACCTCGCTTCCAACAACCAAGTCTTTCAGGACCGATGCGCCTATCTTCTTTCACGGATGATCCATACCG
TCCCAAAAGGCGTTCAATTGACAGATGTTATCACTCCCATTCCCGTCAAGCCCTGGCTTGCTCAATTGAGTATTGACAACAACGGAAAGCTGCAATTTGAAGGCTATATCAGG
GTACGAG
AAGCAATTTTGCCGTGATTGATGACTGACGGATTGTATTCTTAATCATAGATCTTCTCTACAAACAAGTCCCAGTCTCCCAGAGACTACGCCGTCAAGTGAGTTGTCTCACCGAGAGTAG
GACTCGCTGGAGGCCTGAAATTTCACATGTAGCATGACCTGGACGGATCACAATGGTGCAGCCTGTGACGGCTGTAGTGCTACGGCAAGATTCCCTGGGCTCTTCAGCGGCTCGTTCTGG
GGCGCGGTCGCGTTGTTCCACTTCAACATTACCATCGATCCGAGCGTTGGATTCTCTGCATTCAGCGTAGAGTATACAAACACTCCCGGGGGACCTCTAACCAAAGCAGATAATGATGGA
GCTGGTTTCCCTTTCGACGACGTTGCTGTGCTGCACAAGTCGGCCAGCTGCATTGCTAACGATGGTAGCGTCAAAGCTGTCGTTGCG
GTACATCTTGTTGCTTCCAACAACGTTGTAACT
TTCAACTGATTTGTTGTCAAATACCTTGTTAGATCCGCAATGACCAGAAGATAATGTCGGCATATATCATCGCCACATCAGCCGTGAAGCAGGCCGGCTCTATCGCTCGCAAGCTGTCCA
CGGCCTTCGTCAACGTGACCGAAAGCGGCCCCTCCCTGTCCAGCTTGTACACTTTATATTCCGCCGAGTTTAACGTTGGCTTAGTAGAAAACGCTTCATTTGATCTTGTCGTCGAGACCG
GAGGTAAAACTCACATCACTGACTTCGTTCGCCCAAATGGTTTCCAGAGTTGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATACGGGGTGTAGCAAGCCTTGTCATCCCGCTATCTATTTCACTCCTTTCAGACGGATACCAAAGGCCAGATACTGTCTACGACGCTCTCGAGGATTTGTACACGGTGAACAGCGGA
CTGGGTTCCAGCAATTTCATTGCAGGGGTTTCACCATGCAGTTTCGCTCCGGCTAATACCAGGACTACTGGCAGGCAAGCTGCTGCTGAGTGGGTCCGCAC
TGCGTACCATGATATGGCT
ACGGCAGATGTGGAAGCTGGCACTGGTGGAATTGATGCCTCTATCACTTTTGAGACCGATCGCGCAGAAAATGTCGGTGATGCTTTCAACGCCAGCTTCAATTTCTTTGTCGGGTTCCAA
AACAAGCGTGTATCCA
TGTCTGACCTCATCGCACTCGGAACTGTTTATGCTGTCCGTGCATGCTCAGGGCCTTCCATATCTTACCGGGCCGGTCGTATCGATGCCACAGGGCCTGGTTCT
AAGGGCGTCCCTGAGCCCCAAGGAGATCTTGCAACGCATACTGCTTCGTTCGCGAAACAAGGCTTTAATGTGAGCGAGATGATTGGTCTCGTGGCATGTGGACACACTCTAGGTGGTGTC
CACGAGCAAGATTTTTCTACAATTGTGCAGGGAGAGACGAATGCAGATAACAACACGAGTGGAATGCAACATTTCGACGACTCTTTTGACTCTTTCGACAACCACAT
CGCTGTACAATGG
ATGAACAGTAGTACTTCTACCAATACACTGGCGACTGGCTTCAATACCACGACAAACTCGGATGCGCGTATATTTGCTGCCGACGGCAATGCCACCATGCGCGACCTCGCTTCCAACAAC
CAAGTCTTTCAGGACCGATGCGCCTATCTTCTTTCACGGATGATCCATACCGTCCCAAAAGGCGTTCAATTGACAGATGTTATCACTCCCATTCCCGTCAAGCCCTGGCTTGCTCAATTG
AGTATTGACAACAACGGAAAGCTGCAATTTGAAGGCTATATCAGG
ATCTTCTCTACAAACAAGTCCCAGTCTCCCAGAGACTACGCCGTCAACATGACCTGGACGGATCACAATGGTGCA
GCCTGTGACGGCTGTAGTGCTACGGCAAGATTCCCTGGGCTCTTCAGCGGCTCGTTCTGGGGCGCGGTCGCGTTGTTCCACTTCAACATTACCATCGATCCGAGCGTTGGATTCTCTGCA
TTCAGCGTAGAGTATACAAACACTCCCGGGGGACCTCTAACCAAAGCAGATAATGATGGAGCTGGTTTCCCTTTCGACGACGTTGCTGTGCTGCACAAGTCGGCCAGCTGCATTGCTAAC
GATGGTAGCGTCAAAGCTGTCGTTGCG
ATCCGCAATGACCAGAAGATAATGTCGGCATATATCATCGCCACATCAGCCGTGAAGCAGGCCGGCTCTATCGCTCGCAAGCTGTCCACGGCC
TTCGTCAACGTGACCGAAAGCGGCCCCTCCCTGTCCAGCTTGTACACTTTATATTCCGCCGAGTTTAACGTTGGCTTAGTAGAAAACGCTTCATTTGATCTTGTCGTCGAGACCGGAGGT
AAAACTCACATCACTGACTTCGTTCGCCCAAATGGTTTCCAGAGTTGCTAG

Retrieve as FASTA