Entry information : EcamGPx01 ( EcC011920.20)
Entry ID 10579
Creation 2012-02-28 (Qiang Li)
Last sequence changes 2016-01-25 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-25 (Christophe Dunand)
Peroxidase information: EcamGPx01 ( EcC011920.20)
Name (synonym) EcamGPx01 ( EcC011920.20)
Class Plant glutathione peroxidase    [Orthogroup: Gpx2001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamGPx01
start..stop
S start..stop
EglGPx01 396 2e-143 1..192 1..192
EguGPx01 395 3e-143 1..192 1..192
EgrGPx01 395 4e-143 1..192 1..192
EgrGPx02 388 3e-140 1..192 1..192
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..150 150 N° 2 579..655 77 N° 3 1068..1129 62 N° 4 1233..1351 119
N° 5 1699..1881 183  
join(1..150,579..655,1068..1129,1233..1351,1699..1881)


exon

Literature and cross-references EcamGPx01 ( EcC011920.20)
EST ref. GenBank:   FY797725.1
Protein sequence: EcamGPx01 ( EcC011920.20)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   197 (171)
PWM (Da):   %s   22207.28 (19107.7) Transmb domain:   %s   i7-26o
PI (pH):   %s   8.01 (7.18) Peptide Signal:   %s   cut: 27 range:27-197
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQWFKSPSFFPFLFALLALSVYFFNAHRPASRAPEMAEESSKSIYDFAVKDIRGNDVSLSEYSGKVLLIVNVASKCGLTQSNYKELNTLYEKYKDGFEVLAFPCNQFAGQEPGSNEEIQETVCTMFKAEFPIFDVEVNGKNAAPLYKFLKSQKGGIFGDGIKWNFTKFLVNREGKVVERYAPTTSPLKIEVRDLI

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST..
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGTGGTTCAAATCCCCCAGCTTCTTCCCATTCCTCTTCGCTCTTCTAGCTCTCTCCGTCTACTTCTTCAACGCGCATCGACCGGCGTCTCGTGCTCCTGAAATGGCCGAGGAATCG
TCCAAGTCCATCTACGATTTCGCCGTCAAG
GTGCCTTTTTCTTTTTTCTTTTGAGATGTCGACTGGATGATGGGTGGTGGTTATCCTGTTCTGTCTGCTCCTGGGTTGGAGAGGGGAGAG
AGGTTTTAGAGGCTGCGCTATGTGCAAGATTGGAACTTTAGCGTGCGGTCGAAGATGGGTCCTTTTGTTTTTTTTTTTTTTTTTTTTTGGGGAGGGGGGGGGGGGCGGGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTATAGTTAGAGATATTTATGACTGTAGATGTCAATTATCTGATGCATATGCAGGACATTCGTGGAAATGATGTAA
GTTTGAGCGAGTACTCTGGGAAGGTTCTTCTGATTGTCAACGTTGCTTCAAAATG
GTATCGCCACTGAATGCGCCTTCTCTTCAAGAATTGTGTTTCTTTGATTAGAACCTCGATAGGAA
TTTAGCAACTCAAGCGTTCATGATAAGGTTTAGTAGTTGACTAGTTGGTCCTGTTGTATGTCACTATGTGTTTGACTGCATGCGGAACACTTGCATGTCCAATCTTGAACCTGTTATCAC
TCTTTTGGTAGTTTAAGCAGCATGAGCCTCTGTCGATCCTGTAAGCCTGGGCTGCTTCTCTTTCCCCTTTAACGGCTATGCATAGATCTATTAACCATTTGTTCTAGATGTAATTGAGTG
GCCAATTGTTCAATCCAGTTCATGTTCCCAGTAACAGTCAACTCCTTGAACTTATATCATCTGCTTTGATACTTATGATATCTAATATAGCGCACACATGTTTGCAGTGGTCTCACCCAA
TCAAATTACAAGGAATTGAACACTTTATATGAAAAATACAAGGATCAAG
GTTTGCTCTTTGGTCTTTTGTGTTTTGATTTCATTCTCATATGTTTTACTCTGCGCTATATCCTTGGGGTT
TGTATAGGTTCATGACTGACATTTCTTTGCAGGATTTGAAGTACTGGCATTTCCATGCAACCAGTTTGCAGGACAAGAGCCAGGGAGTAATGAAGAGATTCAAGAGACTGTATGCACTAT
GTTCAAGGCTGAATTCCCTATTTTTGACAAG
GTAAACATGAGAAGCCCAAAACAATGAGAAAAATATTAAATTGAAAGGGAATTCTTGATATTCTGGCTCCTCATGCTTTTTGGTCGTTT
TAACTTGAGAGCACTATCAATCTCATAGTACGCATAAAAATTGATGATTGACCAGTTGCAGATGAGGTTGAGAATTTGCTTGCAATGTGTTTCATTTTCTCTTTCCACAGTGTGATAAAA
GAGACTTGTTCTATATGCAAGTTCAAGTTGCATAACCATCCTCCTCTTTTGCAAATTTGACTGTGTACAATATGGAGAAAATATGTTCTGAGTTGATATTACACTCTATTTTTGATATTG
TAGTCTATTGTGCTACAGGTTGAGGTGAATGGCAAGAATGCAGCCCCTCTCTACAAGTTTTTAAAATCTCAGAAAGGAGGGATATTTGGAGATGGCATCAAATGGAACTTTACAAAGTTT
CTGGTGAACAGAGAAGGGAAAGTTGTGGAGAGATATGCTCCCACTACATCACCTCTTAAAATTGAGGTTAGGGATCTGATT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGTGGTTCAAATCCCCCAGCTTCTTCCCATTCCTCTTCGCTCTTCTAGCTCTCTCCGTCTACTTCTTCAACGCGCATCGACCGGCGTCTCGTGCTCCTGAAATGGCCGAGGAATCG
TCCAAGTCCATCTACGATTTCGCCGTCAAG
GACATTCGTGGAAATGATGTAAGTTTGAGCGAGTACTCTGGGAAGGTTCTTCTGATTGTCAACGTTGCTTCAAAATGTGGTCTCACCCAA
TCAAATTACAAGGAATTGAACACTTTATATGAAAAATACAAGGATCAAG
GATTTGAAGTACTGGCATTTCCATGCAACCAGTTTGCAGGACAAGAGCCAGGGAGTAATGAAGAGATTCAA
GAGACTGTATGCACTATGTTCAAGGCTGAATTCCCTATTTTTGACAAG
GTTGAGGTGAATGGCAAGAATGCAGCCCCTCTCTACAAGTTTTTAAAATCTCAGAAAGGAGGGATATTTGGA
GATGGCATCAAATGGAACTTTACAAAGTTTCTGGTGAACAGAGAAGGGAAAGTTGTGGAGAGATATGCTCCCACTACATCACCTCTTAAAATTGAGGTTAGGGATCTGATT

Retrieve as FASTA