Entry information : EcamRboh03 ( EcC012018.20)
Entry ID 10580
Creation 2012-02-28 (Qiang Li)
Last sequence changes 2016-04-07 (Christophe Dunand)
Sequence status partial
Reviewer Achraf Jemmat
Last annotation changes 2016-04-07 (Achraf Jemmat)
Peroxidase information: EcamRboh03 ( EcC012018.20)
Name (synonym) EcamRboh03 ( EcC012018.20)
Class Respiratory burst oxidase homolog     [Orthogroup: Rboh001]*
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamRboh03
start..stop
S start..stop
EglRboh03 1170 0 1..604 1..603
EglRboh03 215 2e-60 574..678 710..814
EguRboh03 1121 0 29..604 13..587
EguRboh03 217 4e-61 574..678 694..798
EgrRboh03 1117 0 28..604 12..587
EgrRboh03 215 2e-60 574..678 694..798
VvRboh08 788 0 25..575 52..602
VvRboh08 177 6e-47 574..678 739..843
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..294 294 N° 2 405..568 164 N° 3 670..718 49 N° 4 800..913 114
N° 5 992..1798 807 N° 6 1925..2020 96 N° 7 2123..2238 116 N° 8 2330..2408 79
N° 9 2755..2883 129 N° 10 2979..3057 79 N° 11 3211..3320 110  
join(1..294,405..568,670..718,800..913,992..1798,1925..2020,2123..2238,2330..240 8,2755..2883,2979..3057,3211..3320)


exon

Literature and cross-references EcamRboh03 ( EcC012018.20)
Protein sequence: EcamRboh03 ( EcC012018.20)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   678
PWM (Da):   %s   77542.44 Transmb domain:   %s   i262-281o348-370i398-420o446-468i
PI (pH):   %s   10.12
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDSAVEASESSAPPHPNDIPLPSRRSSSTTRKRNVSYGGIPRMERTASSASRGLMSLRFLDRTITGKEADAWRSIEKRFHQHATNGQLSRDKFGVSIGGMGDSKEFAGELFDALSRRRKVNAENGISIDQLRQFWEDMTTRELESRLQIFFDMCDKNGDGRLTEDEVKVIVLSAASNRLSNLQQQAASHASLIMERLDPDHQGYIEMWQLKTLLREMVNPDQRSKLSVNSQNLTRTMLPKGYRKPMSRLVHKNIERIYDNWRRIWVVGLWLVANMILFLWKFNKTRHSPAFNITGYCLCYAKGSAETLNLNMALVLLPVCRRTLTKLRSSFLGTFIPFDDNINFHKIIALAIAIGSVVHTAMHFMCNFPRITSCPKSQFMQVFGPSFHNRQPHYIDLVNNLSSTTGVLMFMMMAFSFTLATHWFRKNIVKLPWGLHHLAGFNAFWYAHHLLAVAYVFFILHGYFLVISRPWYTKTAWMYVMVPILLYTSERAFTSASELQHRVDIAKAIVYSGNVLALYMSKPPGFNYNSGMYLFVKCPDISKFEWHPFSITSAPGDAFLSVHMRALGDWTNVIEMHNYLTSLYEEGDARSALIAMVQKLQHAKNGVDIFSESRIKTHFARPNWRKVFSEIAMRHKSSRIGVFYCGSSVLTKTLRKLCQELSLESSTRFQFHKENF

Retrieve as FASTA  
Remarks Partial sequence from genomic (part of the sequence is missing due to NNNNNN in DNA). Incorrect prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACAGTGCGGTGGAAGCCAGTGAGAGCTCCGCCCCGCCGCATCCTAATGACATACCATTGCCATCGAGGCGGAGCTCAAGCACGACGCGGAAGAGGAATGTATCGTACGGCGGCATC
CCTAGGATGGAAAGAACGGCATCCAGTGCCTCTCGAGGCCTCATGAGCTTGAGGTTTCTGGATAGGACAATTACCGGGAAGGAAGCAGATGCCTGGAGATCAATCGAGAAGCGTTTCCAT
CAACACGCGACGAACGGCCAACTCTCGAGAGACAAATTTGGAGTCAGCATTGGT
TGATCCTTAGAAAGTCTTGCTGCTATCTGAATCATGATTTTCCAAATAATAATAATAATACTAATT
GCACAATTTGATTGAGAAGTGACATTGTTTTAATCTGCGTGGAAGGAATGGGAGATTCCAAGGAATTTGCAGGAGAGTTATTCGACGCCTTATCAAGACGGAGGAAAGTGAATGCCGAGA
ATGGAATATCAATAGACCAATTGAGACAATTTTGGGAAGACATGACGACTCGAGAACTCGAATCCCGGCTGCAGATATTCTTTGATAT
GTAAAGCAACTCTCGTCCATCTCCTATTATCG
TTCGCAACCTAAAGCGTACATTGCGTTGCTGGTATTCCATGTGATGAAGTTTTGCGACGAATGCTGCAGGTGTGACAAGAATGGTGATGGGAGGCTAACTGAGGATGAGGTAAAAGAGGT
GAGGCAAAAGGAGACTTACTAATCACTCGTTTAGCGTGTCCTTTGGGCTCTTTTATGATGGACTGGAAATTTTTCAAAGGTGATAGTGTTGAGCGCCGCCTCGAATAGGCTGTCGAATCT
CCAGCAGCAAGCGGCATCTCACGCATCTTTGATCATGGAAAGACTTGATCCCGACCATCAAGGGTACATCGAG
GTACCAAGTCAGATAGTCCATCATGTCCTGTTCGAGTTCGTGTTCCT
CCCATGTTGTTCATCGCTTCTTTGTTTTCAGATGTGGCAATTAAAGACTCTACTGAGAGAAATGGTGAACCCTGATCAAAGGAGCAAGTTGTCAGTGAATTCTCAAAACCTGACCAGAAC
CATGCTTCCCAAAGGATACAGAAAACCAATGAGTCGGCTCGTGCACAAGAACATCGAAAGGATCTATGACAATTGGAGGCGAATATGGGTCGTCGGGCTGTGGCTGGTCGCAAACATGAT
CCTCTTCCTTTGGAAGTTTAACAAAACGAGGCACAGCCCCGCCTTTAACATCACGGGCTATTGTCTTTGCTACGCCAAGGGCTCTGCCGAGACACTCAATCTCAACATGGCTCTCGTCCT
CCTCCCCGTATGCAGAAGAACTCTCACGAAGCTACGGTCGTCCTTCCTTGGTACCTTCATACCATTCGACGACAACATAAACTTCCACAAGATAATCGCGCTGGCCATAGCTATAGGATC
TGTCGTTCACACTGCAATGCATTTTATGTGCAACTTCCCCAGGATAACTTCATGCCCAAAATCACAATTCATGCAAGTGTTTGGCCCGAGCTTCCATAATAGGCAACCTCATTACATCGA
CTTGGTCAATAACTTGTCCAGCACCACCGGGGTTCTCATGTTCATGATGATGGCCTTCTCTTTCACACTGGCGACTCATTGGTTCAGGAAAAACATCGTCAAGCTACCGTGGGGGCTCCA
TCATTTAGCAGGATTTAATGCCTTCTGGTACGCACATCATTTGCTAGCCGTTGCCTATGTCTTCTTCATACTTCACGGCTACTTCCTCGTGATCAGTCGACCTTGGTACACGAAAACG
GT
AAGTACACAATGGTCTAATTCCTTATTCTGTTCACCATTAATTCATAAGGCCTGAATTCTCCGGTAGTACCATCATTCCTCTGAAAACACGGCAAGAATCATTATACGGTTGGACTTTAT
GCAGGCATGGATGTATGTGATGGTCCCAATCCTACTCTACACAAGCGAGAGAGCATTCACATCTGCTTCTGAACTCCAACATCGAGTTGATATCGCTAAGGTATCACTCACTTTACCGAA
CTGCCGTGTTCCACATTCCTTTTTGGTTTACACGAATCTTAGTGCTACGATAAATTCATGCTCGGCTCAAAAAACTTTTCAGGCCATTGTTTATTCTGGAAACGTCCTTGCATTGTACAT
GAGCAAGCCTCCAGGTTTCAACTACAACAGCGGAATGTACCTTTTCGTCAAATGCCCTGATATATCAAAGTTCGAATG
GTGTATAGAACATAATCGCTGAAACCTATTTACTCGTCATAC
CCCTATGGCTTTTATTGCTGAAACTCATCGGTGTTTTTGCTCGGGACAGGCATCCTTTCTCCATTACTTCCGCACCGGGAGATGCCTTCTTGAGTGTTCACATGCGAGCCTTGGGCGATT
GGACNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGAATCCTCCAATTAATTATAGTTTTTCAACTAAAATGTCGCTTTGGGTACTGGTGATTGTTGTAGAATGTA
ATAGAGATGCACAACTACCTGACCTCTCTATATGAGGAAGGAGATGCAAGATCAGCACTCATTGCCATGGTCCAAAAGTTGCAGCATGCGAAGAATGGCGTCGACATCTTCTCGGAAAGT
CGG
GTAACTCTTGATCAGTCACCCAAAAGAAAAACAAAGAAACATTCACAGCACAATGCACCTATTTAGGCTGTCCTTTAACGTTGCTTGTTCGACAGATAAAAACTCACTTTGCGAGGC
CTAATTGGAGAAAGGTGTTCTCTGAAATTGCAATGCGGCACAAGTCGTCTCGTATAG
GTATGACATCACATCCGATGAACGTGTCAACATAATGGCACTTGATTTGGTTGTTCTAGCCAG
TTTGGAACATGAACCTGTGATTTTCTAACTGTTGGAACTTGAACATTCTACCAATTCGGGTCTGATATGTCGGTAATAATTTTCCTGCAGGTGTTTTCTATTGTGGGAGTTCGGTGCTCA
CCAAAACACTGAGGAAGCTATGTCAAGAACTCAGCCTAGAGTCGTCAACTCGCTTCCAATTCCACAAGGAAAACTTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACAGTGCGGTGGAAGCCAGTGAGAGCTCCGCCCCGCCGCATCCTAATGACATACCATTGCCATCGAGGCGGAGCTCAAGCACGACGCGGAAGAGGAATGTATCGTACGGCGGCATC
CCTAGGATGGAAAGAACGGCATCCAGTGCCTCTCGAGGCCTCATGAGCTTGAGGTTTCTGGATAGGACAATTACCGGGAAGGAAGCAGATGCCTGGAGATCAATCGAGAAGCGTTTCCAT
CAACACGCGACGAACGGCCAACTCTCGAGAGACAAATTTGGAGTCAGCATTGGT
GGAATGGGAGATTCCAAGGAATTTGCAGGAGAGTTATTCGACGCCTTATCAAGACGGAGGAAAGTG
AATGCCGAGAATGGAATATCAATAGACCAATTGAGACAATTTTGGGAAGACATGACGACTCGAGAACTCGAATCCCGGCTGCAGATATTCTTTGATAT
GTGTGACAAGAATGGTGATGGG
AGGCTAACTGAGGATGAGGTAAAAGAG
GTGATAGTGTTGAGCGCCGCCTCGAATAGGCTGTCGAATCTCCAGCAGCAAGCGGCATCTCACGCATCTTTGATCATGGAAAGACTTGATCCC
GACCATCAAGGGTACATCGAG
ATGTGGCAATTAAAGACTCTACTGAGAGAAATGGTGAACCCTGATCAAAGGAGCAAGTTGTCAGTGAATTCTCAAAACCTGACCAGAACCATGCTTCCC
AAAGGATACAGAAAACCAATGAGTCGGCTCGTGCACAAGAACATCGAAAGGATCTATGACAATTGGAGGCGAATATGGGTCGTCGGGCTGTGGCTGGTCGCAAACATGATCCTCTTCCTT
TGGAAGTTTAACAAAACGAGGCACAGCCCCGCCTTTAACATCACGGGCTATTGTCTTTGCTACGCCAAGGGCTCTGCCGAGACACTCAATCTCAACATGGCTCTCGTCCTCCTCCCCGTA
TGCAGAAGAACTCTCACGAAGCTACGGTCGTCCTTCCTTGGTACCTTCATACCATTCGACGACAACATAAACTTCCACAAGATAATCGCGCTGGCCATAGCTATAGGATCTGTCGTTCAC
ACTGCAATGCATTTTATGTGCAACTTCCCCAGGATAACTTCATGCCCAAAATCACAATTCATGCAAGTGTTTGGCCCGAGCTTCCATAATAGGCAACCTCATTACATCGACTTGGTCAAT
AACTTGTCCAGCACCACCGGGGTTCTCATGTTCATGATGATGGCCTTCTCTTTCACACTGGCGACTCATTGGTTCAGGAAAAACATCGTCAAGCTACCGTGGGGGCTCCATCATTTAGCA
GGATTTAATGCCTTCTGGTACGCACATCATTTGCTAGCCGTTGCCTATGTCTTCTTCATACTTCACGGCTACTTCCTCGTGATCAGTCGACCTTGGTACACGAAAACG
GCATGGATGTAT
GTGATGGTCCCAATCCTACTCTACACAAGCGAGAGAGCATTCACATCTGCTTCTGAACTCCAACATCGAGTTGATATCGCTAAG
GCCATTGTTTATTCTGGAAACGTCCTTGCATTGTAC
ATGAGCAAGCCTCCAGGTTTCAACTACAACAGCGGAATGTACCTTTTCGTCAAATGCCCTGATATATCAAAGTTCGAATG
GCATCCTTTCTCCATTACTTCCGCACCGGGAGATGCCTTC
TTGAGTGTTCACATGCGAGCCTTGGGCGATTGGACNNNN
AATGTAATAGAGATGCACAACTACCTGACCTCTCTATATGAGGAAGGAGATGCAAGATCAGCACTCATTGCCATGGTCCAA
AAGTTGCAGCATGCGAAGAATGGCGTCGACATCTTCTCGGAAAGTCGG
ATAAAAACTCACTTTGCGAGGCCTAATTGGAGAAAGGTGTTCTCTGAAATTGCAATGCGGCACAAGTCGTCT
CGTATAG
GTGTTTTCTATTGTGGGAGTTCGGTGCTCACCAAAACACTGAGGAAGCTATGTCAAGAACTCAGCCTAGAGTCGTCAACTCGCTTCCAATTCCACAAGGAAAACTTTTAG

Retrieve as FASTA