Entry information : AbraCcP
Entry ID 10587
Creation 2012-02-29 (Christophe Dunand)
Last sequence changes 2012-02-29 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: AbraCcP
Name AbraCcP
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Alternaria
Organism Alternaria brassicicola    [TaxId: 29001 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbraCcP
start..stop
S start..stop
AalteCcP01 750 0 1..373 1..374
PterCcP01 721 0 1..373 1..374
PtritCcP 716 0 1..373 1..374
COsaCcP 701 0 1..373 1..373
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 771095..771504 410 N° 2 770332..771043 712  
complement(join(770332..771043,771095..771504))


exon

Literature and cross-references AbraCcP
DNA ref. JGI genome:   Contig3 (771504..770332)
Cluster/Prediction ref. JGI gene:   3903
Protein sequence: AbraCcP
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   374
PWM (Da):   %s   41738.62  
PI (pH):   %s   8.65
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASASRSFSRALSTATPLLRTTSTRSSARFVAPTQSALRNQRRGYASQEGPDKHEGNPTGLAWGAGALLVGAGVYSLYTYKPELFGQTSSKKIFTPRFEDYQKVYDHIAKRLEEHDDYDDGSYGPVLLRLAWHASGTYDKLTGTGGSNGATMRFAPEGDHGANAGLKAARDFLEPVKQAFPWITYSDLWILAGVCAIQEMQGPKIPYRAGRSDRDVSYCTPDGRLPDASKDASHIRAIFGRMGFDDRAMVALSGAHALGRCHTDRSGFDGPWTFSPTTLTNDYYKLLVEEKWAWKKWNGPKQFEDVKTKSLMMLPTDMELVKDKSFRKYTDLYAKDNDAFFKDFSESVMTLFELGVPFQQPEDQRYVFKSSFD

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCTGCCTCACGAAGCTTCTCTCGCGCCCTGTCCACCGCCACGCCCTTGTTGCGCACTACCTCGACGCGCTCGTCTGCCCGCTTCGTCGCACCCACACAAAGCGCGTTGCGCAAC
CAGCGACGTGGATACGCTTCCCAGGAAGGTCCAGACAAGCATGAGGGCAACCCAACTGGCCTAGCTTGGGGAGCTGGTGCTCTCCTTGTCGGTGCTGGTGTATACAGCCTGTACACATAC
AAGCCCGAGTTGTTCGGTCAGACCAGCAGCAAGAAAATCTTCACCCCAAGATTCGAAGATTACCAAAAGGTCTACGACCACATCGCAAAGAGGCTTGAGGAGCACGACGACTACGACGAT
GGCAGCTACGGACCTGTACTCCTGCGTCTGGCATGGCACGCCTCGGGAAC
GTGAGTACCCTGAAGCCTTCTCCGTCAAACAAGGATGCTAATGAGTACCAGCTACGACAAGCTGACCGGA
ACTGGTGGCTCCAACGGTGCTACCATGCGCTTCGCCCCCGAAGGTGACCATGGCGCCAACGCTGGTCTCAAGGCCGCCCGCGACTTCCTCGAGCCCGTCAAGCAGGCTTTCCCATGGATC
ACATACTCGGACCTGTGGATTCTCGCTGGTGTCTGTGCCATCCAAGAGATGCAGGGTCCCAAGATCCCATACCGAGCTGGCCGCAGCGACCGTGACGTCTCCTACTGCACACCCGACGGT
CGTCTGCCCGACGCGAGCAAGGACGCTAGCCACATCCGCGCCATCTTCGGCCGTATGGGCTTCGACGATCGCGCCATGGTCGCCCTATCCGGTGCCCACGCCCTGGGTCGCTGCCACACC
GACCGTTCTGGCTTCGACGGTCCTTGGACCTTCTCTCCCACCACCCTGACCAACGACTACTACAAGCTCCTTGTCGAGGAGAAGTGGGCATGGAAGAAGTGGAACGGCCCCAAGCAGTTC
GAGGACGTCAAGACCAAGAGCTTGATGATGCTGCCGACTGACATGGAGCTTGTCAAGGACAAGAGCTTCAGGAAGTACACTGACCTATACGCAAAGGACAACGACGCTTTCTTCAAGGAC
TTCTCCGAGAGCGTCATGACTCTGTTTGAGCTCGGCGTACCGTTCCAGCAACCTGAAGACCAGCGCTACGTCTTCAAGAGCTCTTTCGACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCTGCCTCACGAAGCTTCTCTCGCGCCCTGTCCACCGCCACGCCCTTGTTGCGCACTACCTCGACGCGCTCGTCTGCCCGCTTCGTCGCACCCACACAAAGCGCGTTGCGCAAC
CAGCGACGTGGATACGCTTCCCAGGAAGGTCCAGACAAGCATGAGGGCAACCCAACTGGCCTAGCTTGGGGAGCTGGTGCTCTCCTTGTCGGTGCTGGTGTATACAGCCTGTACACATAC
AAGCCCGAGTTGTTCGGTCAGACCAGCAGCAAGAAAATCTTCACCCCAAGATTCGAAGATTACCAAAAGGTCTACGACCACATCGCAAAGAGGCTTGAGGAGCACGACGACTACGACGAT
GGCAGCTACGGACCTGTACTCCTGCGTCTGGCATGGCACGCCTCGGGAAC
CTACGACAAGCTGACCGGAACTGGTGGCTCCAACGGTGCTACCATGCGCTTCGCCCCCGAAGGTGACCAT
GGCGCCAACGCTGGTCTCAAGGCCGCCCGCGACTTCCTCGAGCCCGTCAAGCAGGCTTTCCCATGGATCACATACTCGGACCTGTGGATTCTCGCTGGTGTCTGTGCCATCCAAGAGATG
CAGGGTCCCAAGATCCCATACCGAGCTGGCCGCAGCGACCGTGACGTCTCCTACTGCACACCCGACGGTCGTCTGCCCGACGCGAGCAAGGACGCTAGCCACATCCGCGCCATCTTCGGC
CGTATGGGCTTCGACGATCGCGCCATGGTCGCCCTATCCGGTGCCCACGCCCTGGGTCGCTGCCACACCGACCGTTCTGGCTTCGACGGTCCTTGGACCTTCTCTCCCACCACCCTGACC
AACGACTACTACAAGCTCCTTGTCGAGGAGAAGTGGGCATGGAAGAAGTGGAACGGCCCCAAGCAGTTCGAGGACGTCAAGACCAAGAGCTTGATGATGCTGCCGACTGACATGGAGCTT
GTCAAGGACAAGAGCTTCAGGAAGTACACTGACCTATACGCAAAGGACAACGACGCTTTCTTCAAGGACTTCTCCGAGAGCGTCATGACTCTGTTTGAGCTCGGCGTACCGTTCCAGCAA
CCTGAAGACCAGCGCTACGTCTTCAAGAGCTCTTTCGACTAA

Retrieve as FASTA