Entry information : AbraAPx-CcP
Entry ID 10588
Creation 2012-02-29 (Christophe Dunand)
Last sequence changes 2012-02-29 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: AbraAPx-CcP
Name AbraAPx-CcP
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Alternaria
Organism Alternaria brassicicola    [TaxId: 29001 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbraAPx-CcP
start..stop
S start..stop
PnoAPx-CcP01 710 0 12..495 47..531
SturAPx-CcP02 686 0 12..495 47..530
ClunAPx-CcP02 683 0 12..484 47..520
COsaAPx-CcP02 659 0 12..484 47..519
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1543944..1543961 18 N° 2 1542438..1543907 1470  
complement(join(1542438..1543907,1543944..1543961))


exon

Literature and cross-references AbraAPx-CcP
DNA ref. JGI genome:   Contig4 (1543961..1542438)
Cluster/Prediction ref. JGI gene:   5128
Protein sequence: AbraAPx-CcP
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   496
PWM (Da):   %s   53506.86  
PI (pH):   %s   5.23
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDRSPIAHKVTEVMTCGFGANEPGIQKTAEWVRTAFHDAVTHDAKTKIGGLDASIQYELDRPENLGAALNNTLSDISSAVNMRTSAADLLALSLVMSVARCADMRIPLRLGRKDATEAGIKGVPEAHTDLDTTKKRFETASLSETDMITLIACGHSIGGVHSVDHPEIVSGPVSAENKASFDTSKAVLDNNVVLEYLDNSTANPLIVNANNTLNSDKRIFAADDNKTMRKLADKAYFKSQCEAAFEKMINLVPGDVTLSEPLEPADIRPYISSYQLKDGSVQFSGNVRVRITPVTGRDENSLTASIIPASRGNTTVAEFAARRGRFRGGTSSGYLDEQFLWFEFDQTLNASEAFTSFTIRVNDEIYDNGGTGGYPVNADVLYQKAQSCIVWNEGKGEYTMSITAAVAKSLLQGGAAPQINVGRKTKIQGNHIPRLQSEIIPMTRSSKETAEYVYFTASTILPNGGHDPKVDIEVGDSKVEFITTNDLAGKQCAPL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (no intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCGCTCTCCGATCGTATGTATTCTACATCCTTGACTTGTTCCACCGAAGGCTCACAAAGTAACAGAAGTCATGACCTGTGGGTTCGGCGCCAACGAACCTGGTATCCAAAAAACT
GCAGAATGGGTGCGCACCGCCTTCCACGATGCCGTCACGCACGATGCCAAAACCAAGATTGGCGGTCTGGATGCCTCGATACAGTACGAACTTGATCGACCAGAGAATCTGGGTGCTGCG
TTGAACAACACTTTGTCCGACATCTCGAGTGCAGTCAACATGAGAACCTCTGCAGCCGACCTTTTGGCCTTGTCATTAGTAATGTCCGTGGCTCGCTGCGCCGATATGCGCATTCCATTG
AGACTAGGCCGCAAGGATGCGACCGAAGCTGGCATCAAAGGCGTACCAGAGGCCCATACGGATCTCGATACCACAAAAAAGCGCTTTGAGACTGCCAGTCTAAGCGAGACCGACATGATC
ACCTTGATTGCTTGCGGTCACAGCATTGGTGGTGTTCACTCTGTTGATCATCCTGAGATTGTATCTGGCCCAGTTAGCGCAGAAAACAAGGCGAGCTTCGATACTAGCAAGGCTGTCTTG
GACAACAACGTGGTATTGGAGTACCTTGACAACTCTACGGCTAATCCGTTAATCGTCAACGCCAACAACACGCTAAACTCCGACAAGCGAATCTTTGCTGCCGATGACAACAAAACCATG
CGCAAACTTGCAGACAAGGCCTACTTCAAGTCCCAGTGCGAGGCCGCCTTTGAAAAGATGATCAATCTCGTACCAGGCGATGTCACACTGTCTGAGCCCCTGGAGCCAGCAGATATCCGC
CCCTACATCTCATCGTATCAACTCAAGGACGGCTCAGTCCAATTCTCTGGAAACGTTCGTGTTCGCATTACGCCAGTGACTGGTCGCGACGAAAATAGTCTTACAGCTTCCATCATCCCA
GCATCGCGCGGCAACACCACAGTCGCCGAGTTCGCCGCTCGCCGTGGCAGGTTCCGTGGAGGAACTTCTTCTGGATACCTCGACGAGCAGTTCCTTTGGTTTGAATTTGACCAGACATTG
AACGCTAGCGAAGCCTTCACCTCGTTTACCATTCGTGTCAACGATGAAATCTACGACAATGGCGGCACAGGCGGATATCCCGTGAACGCCGACGTCCTCTACCAAAAAGCGCAGTCTTGC
ATCGTATGGAATGAAGGCAAGGGCGAATATACGATGAGCATTACTGCTGCCGTGGCCAAATCTCTTCTTCAGGGTGGGGCCGCTCCACAGATCAACGTTGGAAGAAAGACCAAGATTCAG
GGCAACCACATCCCCCGCTTGCAATCAGAGATTATTCCTATGACCCGCTCAAGCAAGGAGACAGCAGAATACGTGTACTTTACTGCCTCGACAATCTTGCCTAATGGGGGGCACGATCCC
AAGGTTGACATTGAAGTTGGTGACTCCAAGGTAGAGTTCATCACGACCAATGATCTTGCAGGAAAACAGTGCGCTCCGTTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCGCTCTCCGATCGCTCACAAAGTAACAGAAGTCATGACCTGTGGGTTCGGCGCCAACGAACCTGGTATCCAAAAAACTGCAGAATGGGTGCGCACCGCCTTCCACGATGCCGTC
ACGCACGATGCCAAAACCAAGATTGGCGGTCTGGATGCCTCGATACAGTACGAACTTGATCGACCAGAGAATCTGGGTGCTGCGTTGAACAACACTTTGTCCGACATCTCGAGTGCAGTC
AACATGAGAACCTCTGCAGCCGACCTTTTGGCCTTGTCATTAGTAATGTCCGTGGCTCGCTGCGCCGATATGCGCATTCCATTGAGACTAGGCCGCAAGGATGCGACCGAAGCTGGCATC
AAAGGCGTACCAGAGGCCCATACGGATCTCGATACCACAAAAAAGCGCTTTGAGACTGCCAGTCTAAGCGAGACCGACATGATCACCTTGATTGCTTGCGGTCACAGCATTGGTGGTGTT
CACTCTGTTGATCATCCTGAGATTGTATCTGGCCCAGTTAGCGCAGAAAACAAGGCGAGCTTCGATACTAGCAAGGCTGTCTTGGACAACAACGTGGTATTGGAGTACCTTGACAACTCT
ACGGCTAATCCGTTAATCGTCAACGCCAACAACACGCTAAACTCCGACAAGCGAATCTTTGCTGCCGATGACAACAAAACCATGCGCAAACTTGCAGACAAGGCCTACTTCAAGTCCCAG
TGCGAGGCCGCCTTTGAAAAGATGATCAATCTCGTACCAGGCGATGTCACACTGTCTGAGCCCCTGGAGCCAGCAGATATCCGCCCCTACATCTCATCGTATCAACTCAAGGACGGCTCA
GTCCAATTCTCTGGAAACGTTCGTGTTCGCATTACGCCAGTGACTGGTCGCGACGAAAATAGTCTTACAGCTTCCATCATCCCAGCATCGCGCGGCAACACCACAGTCGCCGAGTTCGCC
GCTCGCCGTGGCAGGTTCCGTGGAGGAACTTCTTCTGGATACCTCGACGAGCAGTTCCTTTGGTTTGAATTTGACCAGACATTGAACGCTAGCGAAGCCTTCACCTCGTTTACCATTCGT
GTCAACGATGAAATCTACGACAATGGCGGCACAGGCGGATATCCCGTGAACGCCGACGTCCTCTACCAAAAAGCGCAGTCTTGCATCGTATGGAATGAAGGCAAGGGCGAATATACGATG
AGCATTACTGCTGCCGTGGCCAAATCTCTTCTTCAGGGTGGGGCCGCTCCACAGATCAACGTTGGAAGAAAGACCAAGATTCAGGGCAACCACATCCCCCGCTTGCAATCAGAGATTATT
CCTATGACCCGCTCAAGCAAGGAGACAGCAGAATACGTGTACTTTACTGCCTCGACAATCTTGCCTAATGGGGGGCACGATCCCAAGGTTGACATTGAAGTTGGTGACTCCAAGGTAGAG
TTCATCACGACCAATGATCTTGCAGGAAAACAGTGCGCTCCGTTGTAG

Retrieve as FASTA