Entry information : EfeCP_F11
Entry ID 10591
Creation 2012-02-29 (Christophe Dunand)
Last sequence changes 2012-02-29 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-02-29 (Christophe Dunand)
Peroxidase information: EfeCP_F11
Name EfeCP_F11
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Clavicipitaceae Epichloe
Organism Epichloe festucae    [TaxId: 35717 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EfeCP_F11
start..stop
S start..stop
MacrCP01 1315 0 1..735 1..732
MacrCP02 1305 0 1..735 1..732
ManiCP01 1273 0 1..735 1..731
CgloCP02_Naragc5 1151 0 1..731 1..752
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..330 330 N° 2 420..2306 1887  
join(1..330,420..2306)


exon

Literature and cross-references EfeCP_F11
DNA ref. GenBank:   AFRX01000555.1 (48172..45864)
EST ref. GenBank:   GO827328.1 [3' end]   GO827182.1 [Fragment]
Protein sequence: EfeCP_F11
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   738
PWM (Da):   %s   81465.02  
PI (pH):   %s   6.33
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
IAESKCPAQASLNVAGGGTRIHDWWPESVKLNILRQNTSVTNPLGEDFDYAAAFKTLDYEGLKRDLSALMTNSQDLWPADFGHYGGLFIRMAWHSAGTYRVTDGRGGGGHAQQRFAPLNSWPDNVSLDKARRLLWPIKQKYGNKISWADLLILTGNVALESMGFKTFGFAGGRIDDWEADESVYWGGENTWLGNEVRYHNEKDPHKRDLESPLAAAHMGLIYVNPEGPDGNPDPVAAARDIRTTFGRMAMNDEETVALIAGGHSFGKTHGAGPATHVGKEPHGANIEQQGLGWASTYETGKGPHTITSGLEVTWTKTPTKWSNNYFEYLFKYEWELTKSPAGANQWVAKTDDLIIPDAYDSNKFHKPKMLTTDLSLRFDPEYEKISRRFLENPDQFADAFARAWFKLTHRDMGPKCLYIGPEIPKEDLLWQDPIPPVNHALIDDKEVAAIKKEILNLGIDVSQLVSTAWASASTFRSSDKRGGANGARVRLTPQKDWEVNNPAQLSRVLAALEDLQKRLNQSGKTVSLADLIVLAGVAGVEKAARDGGVDINVPFTPGRGDATQEQTDVESGKHLEPVADGFRNHGKSYGAVKQEHLLVDRANLLNLSAPELTVLIGGMRALNTNYDGSAHGVFTSRPGVLTNDFFVNLLDINTEWKQTGEDVFEGFDRKTGARKWSATRNDLIFGHHPELRAVAEVYGSADGTQKFVKDFVAAWDKVMNLDRFDIQKTGNKKAASRL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron) and 2 ESTs. No ATG => probable sequencing error (ATC instead of ATG).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATCGCCGAGAGCAAGTGCCCAGCTCAGGCTTCGCTCAATGTTGCTGGTGGCGGAACCAGAATCCACGACTGGTGGCCCGAGTCGGTCAAGCTCAACATCCTCCGCCAGAACACTTCTGTC
ACCAACCCTCTCGGCGAGGACTTCGACTATGCTGCTGCCTTCAAGACTCTCGACTACGAGGGACTTAAGAGAGATCTGTCCGCCCTCATGACCAATTCTCAGGACCTGTGGCCAGCTGAT
TTCGGCCACTATGGCGGCCTCTTCATTAGAATGGCCTGGCACAGTGCTGGCACATACCGCGTCACAGATGGCCGAGGCGGTGGTGGTCAT
GTGAGTCCTCCAGCCCTCCCTTACACCCTT
TTGTCTTGCAATTAGATGCCTAACTTTGAGCCCTCTCTGGGTTGTCAATCTTATCACAGGCCCAGCAGCGCTTTGCTCCTTTGAACAGCTGGCCCGACAACGTCAGCCTTGACAAGGCCA
GACGTCTGCTCTGGCCCATCAAGCAAAAATACGGCAACAAAATCTCTTGGGCTGATTTGCTGATTCTGACTGGCAATGTCGCCTTGGAGTCCATGGGTTTCAAGACTTTCGGCTTCGCCG
GTGGCCGTATCGACGATTGGGAAGCTGATGAGTCCGTCTATTGGGGTGGTGAGAACACCTGGCTGGGCAACGAGGTTCGGTATCACAATGAGAAGGATCCCCATAAGCGAGACCTCGAAT
CTCCTCTGGCCGCTGCTCACATGGGTTTGATCTACGTGAACCCCGAAGGTCCCGATGGTAACCCTGACCCCGTTGCCGCTGCCCGCGACATCCGCACCACGTTTGGTCGCATGGCCATGA
ACGATGAGGAAACTGTCGCCTTGATCGCAGGTGGTCATTCTTTCGGCAAAACCCATGGAGCCGGCCCTGCCACCCACGTTGGGAAGGAGCCCCATGGTGCCAACATTGAGCAGCAGGGCT
TGGGTTGGGCTAGCACCTACGAAACTGGCAAAGGTCCACACACCATCACCAGTGGTCTCGAAGTTACGTGGACCAAGACTCCCACCAAGTGGAGTAATAATTACTTCGAGTACCTCTTCA
AGTATGAGTGGGAGCTCACCAAGTCCCCTGCTGGCGCCAATCAATGGGTAGCCAAGACCGACGACCTGATCATCCCCGACGCCTACGACTCCAATAAATTCCACAAGCCCAAGATGTTGA
CCACTGATCTGTCTTTGCGCTTCGACCCTGAGTACGAGAAGATTTCTCGTCGTTTCTTGGAGAACCCTGATCAGTTCGCCGATGCCTTCGCTCGTGCCTGGTTCAAGCTCACCCACCGTG
ACATGGGTCCCAAGTGCCTCTACATCGGCCCCGAGATCCCCAAGGAGGACCTCCTCTGGCAGGACCCCATTCCTCCCGTCAACCACGCTTTGATTGACGACAAGGAAGTCGCTGCCATTA
AAAAGGAAATCCTCAACTTGGGCATTGACGTGTCTCAGCTCGTCTCCACCGCTTGGGCATCCGCTTCTACTTTCCGGAGCAGCGACAAGCGCGGCGGTGCCAACGGCGCCCGCGTTCGTC
TGACTCCTCAGAAGGACTGGGAAGTGAACAACCCTGCCCAGCTATCCCGGGTTCTTGCTGCTCTCGAGGATCTTCAGAAGCGCTTGAACCAGAGTGGCAAGACTGTGTCTCTTGCGGATT
TGATCGTGCTGGCTGGCGTTGCCGGTGTCGAGAAGGCTGCTCGTGACGGTGGTGTCGACATTAATGTTCCCTTCACGCCCGGTCGTGGTGATGCCACCCAGGAACAGACGGATGTCGAGT
CAGGCAAGCATCTCGAGCCAGTGGCCGATGGCTTCCGAAACCATGGCAAGTCGTATGGCGCTGTCAAGCAGGAACACCTCTTGGTGGACCGGGCCAACCTGCTGAACTTGTCTGCCCCCG
AGCTCACAGTTTTGATTGGTGGCATGCGTGCCTTGAACACGAATTATGACGGCTCCGCCCATGGTGTTTTCACCTCGCGCCCTGGTGTCTTGACCAATGACTTCTTTGTCAATCTCTTGG
ATATCAATACCGAGTGGAAGCAGACCGGTGAAGACGTCTTTGAGGGTTTTGACCGCAAGACAGGCGCCAGGAAGTGGAGCGCCACTCGCAACGATCTCATCTTCGGACATCACCCCGAAC
TGCGTGCCGTCGCCGAGGTTTATGGCAGTGCTGACGGTACTCAAAAGTTCGTCAAGGACTTTGTGGCCGCGTGGGACAAGGTCATGAACTTGGATCGATTTGACATTCAGAAAACCGGAA
ACAAGAAGGCTGCTAGCCGTCTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATCGCCGAGAGCAAGTGCCCAGCTCAGGCTTCGCTCAATGTTGCTGGTGGCGGAACCAGAATCCACGACTGGTGGCCCGAGTCGGTCAAGCTCAACATCCTCCGCCAGAACACTTCTGTC
ACCAACCCTCTCGGCGAGGACTTCGACTATGCTGCTGCCTTCAAGACTCTCGACTACGAGGGACTTAAGAGAGATCTGTCCGCCCTCATGACCAATTCTCAGGACCTGTGGCCAGCTGAT
TTCGGCCACTATGGCGGCCTCTTCATTAGAATGGCCTGGCACAGTGCTGGCACATACCGCGTCACAGATGGCCGAGGCGGTGGTGGTCAT
GCCCAGCAGCGCTTTGCTCCTTTGAACAGC
TGGCCCGACAACGTCAGCCTTGACAAGGCCAGACGTCTGCTCTGGCCCATCAAGCAAAAATACGGCAACAAAATCTCTTGGGCTGATTTGCTGATTCTGACTGGCAATGTCGCCTTGGAG
TCCATGGGTTTCAAGACTTTCGGCTTCGCCGGTGGCCGTATCGACGATTGGGAAGCTGATGAGTCCGTCTATTGGGGTGGTGAGAACACCTGGCTGGGCAACGAGGTTCGGTATCACAAT
GAGAAGGATCCCCATAAGCGAGACCTCGAATCTCCTCTGGCCGCTGCTCACATGGGTTTGATCTACGTGAACCCCGAAGGTCCCGATGGTAACCCTGACCCCGTTGCCGCTGCCCGCGAC
ATCCGCACCACGTTTGGTCGCATGGCCATGAACGATGAGGAAACTGTCGCCTTGATCGCAGGTGGTCATTCTTTCGGCAAAACCCATGGAGCCGGCCCTGCCACCCACGTTGGGAAGGAG
CCCCATGGTGCCAACATTGAGCAGCAGGGCTTGGGTTGGGCTAGCACCTACGAAACTGGCAAAGGTCCACACACCATCACCAGTGGTCTCGAAGTTACGTGGACCAAGACTCCCACCAAG
TGGAGTAATAATTACTTCGAGTACCTCTTCAAGTATGAGTGGGAGCTCACCAAGTCCCCTGCTGGCGCCAATCAATGGGTAGCCAAGACCGACGACCTGATCATCCCCGACGCCTACGAC
TCCAATAAATTCCACAAGCCCAAGATGTTGACCACTGATCTGTCTTTGCGCTTCGACCCTGAGTACGAGAAGATTTCTCGTCGTTTCTTGGAGAACCCTGATCAGTTCGCCGATGCCTTC
GCTCGTGCCTGGTTCAAGCTCACCCACCGTGACATGGGTCCCAAGTGCCTCTACATCGGCCCCGAGATCCCCAAGGAGGACCTCCTCTGGCAGGACCCCATTCCTCCCGTCAACCACGCT
TTGATTGACGACAAGGAAGTCGCTGCCATTAAAAAGGAAATCCTCAACTTGGGCATTGACGTGTCTCAGCTCGTCTCCACCGCTTGGGCATCCGCTTCTACTTTCCGGAGCAGCGACAAG
CGCGGCGGTGCCAACGGCGCCCGCGTTCGTCTGACTCCTCAGAAGGACTGGGAAGTGAACAACCCTGCCCAGCTATCCCGGGTTCTTGCTGCTCTCGAGGATCTTCAGAAGCGCTTGAAC
CAGAGTGGCAAGACTGTGTCTCTTGCGGATTTGATCGTGCTGGCTGGCGTTGCCGGTGTCGAGAAGGCTGCTCGTGACGGTGGTGTCGACATTAATGTTCCCTTCACGCCCGGTCGTGGT
GATGCCACCCAGGAACAGACGGATGTCGAGTCAGGCAAGCATCTCGAGCCAGTGGCCGATGGCTTCCGAAACCATGGCAAGTCGTATGGCGCTGTCAAGCAGGAACACCTCTTGGTGGAC
CGGGCCAACCTGCTGAACTTGTCTGCCCCCGAGCTCACAGTTTTGATTGGTGGCATGCGTGCCTTGAACACGAATTATGACGGCTCCGCCCATGGTGTTTTCACCTCGCGCCCTGGTGTC
TTGACCAATGACTTCTTTGTCAATCTCTTGGATATCAATACCGAGTGGAAGCAGACCGGTGAAGACGTCTTTGAGGGTTTTGACCGCAAGACAGGCGCCAGGAAGTGGAGCGCCACTCGC
AACGATCTCATCTTCGGACATCACCCCGAACTGCGTGCCGTCGCCGAGGTTTATGGCAGTGCTGACGGTACTCAAAAGTTCGTCAAGGACTTTGTGGCCGCGTGGGACAAGGTCATGAAC
TTGGATCGATTTGACATTCAGAAAACCGGAAACAAGAAGGCTGCTAGCCGTCTTTAG

Retrieve as FASTA