Entry information : EfeAPx-CcP_F11
Entry ID 10594
Creation 2012-02-29 (Christophe Dunand)
Last sequence changes 2012-06-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-04-10 (Christophe Dunand)
Peroxidase information: EfeAPx-CcP_F11
Name EfeAPx-CcP_F11
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Clavicipitaceae Epichloe
Organism Epichloe festucae    [TaxId: 35717 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EfeAPx-CcP_F11
start..stop
S start..stop
MacrAPx-CcP01 1440 0 1..884 1..900
MacrAPx-CcP01 234 3e-65 661..890 574..802
MacrAPx-CcP01 122 9e-29 560..675 795..906
ManiAPx-CcP 1397 0 1..878 1..892
ManiAPx-CcP 234 3e-65 661..890 566..794
ManiAPx-CcP 105 2e-23 560..664 787..895
TaspAPx-CcP01 1222 0 19..876 19..907
TaspAPx-CcP01 234 5e-65 673..890 594..815
TatAPx-CcP01 1214 0 16..879 16..922
TatAPx-CcP01 237 5e-66 673..890 604..825
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6840..8688 1849 N° 2 5889..6748 860  
complement(join(5889..6748,6840..8688))


exon

Literature and cross-references EfeAPx-CcP_F11
DNA ref. GenBank:   AFRX01000198.1 (8688..5889)
EST ref. GenBank:   GO808730.1 [3' end]
Protein sequence: EfeAPx-CcP_F11
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   902 (883)
PWM (Da):   %s   95314.75 (93521.7)  
PI (pH):   %s   5.72 (5.58) Peptide Signal:   %s   cut: 20 range:20-902
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTSPVLLGLLGLAGSALADPTWPSDIDELEEIMFQISSFRSRKFADTVNPCTTEASGPGRRNAAEWLRSAFHDMSTANTFFKTGGLDASLQYELDNGENTGPGHRTTCKFMAPYVTTRSSLSDLLAMGVYMSVRSCGGADGPRVPFRAGRRDATAAGALGVPQPQNSVSTFQQQFQRMGFTTEEMIQVTACGHTIGGVHQEEFPDLMPATGAVNGNVSFDTTDAVFDNKVVTEYLGGNTTNPLVVGISVKHNKNSDFKIYNADGNKTMSTLADASTFKTVCQKVLQKMIDVVPPGVALSEPVVPYTVKPVNLQLTLTNGGSALQFSGYIRVKATGLADGAIRSVTLTYRDRRGSTDCGSSSCSITSTIQGAGKGFDDIFNFYPIEAVIPASTGISSFTVTVNNNDGTSKLYDNNGKGYPLQDDVLFQTPQSCIKGTSGALTVVAAVRNDVAGKGAQAHISYKVPQDNKSPVALLQNATIALVKGACIGKYTLFSADYTIPGGLAYESRVDVLAGDKADSFKALTGIGGTCTPFPNAGACDGGEPSTTRSTTSGAAVVVPSHRATVGGYKHLSCWTEGVSLRALDGISFVNDTMTLEKCAEYCRSFVYWGTEYGRECYCGNSLDKTSAAAPIGDCNMPCGGEPSEYCGAGNRLELYSTTSAPATPTPTATLIHKRTVSSYTLVGCWSEGNGVRALTQGFTASDKMTNEACATFCKNYKYFGTEYGSECYCGSYLADGSKMAPIEECNMPCSGDQYAYCGASSRLELYQNPSITTGNPEQPAAVGDHVLVGCQTEGNGTRALAGSALAQDNMTNEVCANWCKDHEYFGTEYGRECYCGNSLATSSLAAPAAECRMLCAGSSTEYCGASNRLSVYKKEQVTTPPPTGPRSAGKDGKNGKQRIRR

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron) and 3 ESTs. Peroxidase domain fused to 3 WSC domains (putative carbohydrate binding domain)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAACTTCACCAGTCCTGCTGGGCCTCCTTGGCCTGGCTGGATCTGCTCTGGCTGATCCGACCTGGCCTTCGGATATCGACGAACTCGAGGAGATCATGTTCCAAATCAGCTCGTTT
CGATCTCGCAAGTTTGCTGATACAGTGAACCCTTGCACCACCGAAGCCTCGGGTCCGGGTCGACGCAATGCCGCCGAATGGTTGCGATCGGCCTTCCATGACATGTCCACTGCCAACACG
TTCTTCAAAACCGGTGGCCTCGACGCTTCCCTTCAATATGAGCTGGACAATGGCGAGAATACCGGCCCTGGACACAGAACAACCTGCAAATTCATGGCGCCCTATGTCACCACTCGCTCC
TCGTTATCGGATTTGCTCGCCATGGGAGTCTACATGTCTGTTCGCTCTTGTGGTGGTGCCGACGGTCCCAGAGTTCCGTTTCGGGCTGGCAGAAGAGATGCTACTGCTGCTGGCGCATTA
GGTGTACCCCAACCCCAAAATTCGGTTTCTACATTTCAACAACAATTCCAACGCATGGGGTTTACCACGGAGGAGATGATTCAGGTCACGGCCTGTGGTCACACTATCGGAGGCGTTCAT
CAGGAAGAGTTTCCAGACCTCATGCCTGCCACTGGCGCGGTCAATGGCAATGTTTCATTTGATACAACCGACGCAGTTTTCGACAATAAAGTCGTTACCGAGTATCTTGGTGGCAACACC
ACCAACCCTCTCGTCGTGGGCATATCGGTCAAGCACAATAAGAATTCGGATTTCAAGATTTACAACGCGGATGGCAACAAGACCATGTCGACTCTGGCCGACGCCAGCACGTTCAAGACT
GTCTGTCAGAAGGTCTTGCAGAAGATGATTGATGTCGTTCCTCCTGGTGTTGCCCTAAGCGAGCCTGTGGTTCCATATACCGTCAAGCCTGTCAATTTGCAGCTTACTCTCACCAATGGA
GGATCCGCCCTGCAATTCTCGGGGTACATTCGAGTCAAAGCAACTGGCCTCGCAGATGGCGCCATCAGGAGCGTCACACTCACGTACAGAGATCGCAGGGGCTCCACCGACTGCGGCTCC
AGCTCTTGCAGCATCACGAGCACCATACAGGGAGCCGGCAAGGGTTTTGATGACATCTTCAACTTCTACCCGATCGAAGCTGTTATTCCTGCCTCGACTGGCATCTCATCTTTCACTGTG
ACTGTCAATAACAATGACGGAACGAGCAAGCTTTACGACAACAACGGCAAGGGATATCCCCTCCAGGACGACGTCTTGTTCCAAACACCCCAAAGCTGCATCAAGGGCACCTCGGGTGCT
CTCACTGTTGTCGCTGCTGTCCGCAACGATGTGGCTGGCAAAGGCGCCCAGGCCCACATCTCATACAAAGTTCCTCAAGACAACAAAAGTCCCGTCGCTCTCCTTCAGAATGCCACCATT
GCCCTGGTCAAGGGTGCTTGCATTGGCAAGTATACACTGTTCTCGGCCGACTACACAATCCCGGGTGGCTTGGCATACGAGTCCCGCGTTGATGTCCTCGCTGGAGATAAGGCAGATAGT
TTCAAGGCCCTGACCGGTATCGGCGGGACATGTACTCCGTTTCCAAATGCTGGAGCTTGTGACGGTGGAGAGCCTTCTACCACCAGGAGCACAACTTCTGGTGCAGCTGTTGTGGTCCCA
AGTCACCGTGCTACTGTTGGCGGCTACAAGCATTTGTCTTGCTGGACTGAAGGTGTTTCTCTGCGCGCCTTGGACGGCATCTCTTTTGTCAACGACACAATGACTCTTGAGAAGTGTGCC
GAATACTGCCGTTCCTTTGTGTACTGGGGTACCGAGTATGGTCGTGAAT
GTGAGCTTCCGGTCCGGTCCCATGATACGGCGTCACCTGTATTCCAGCTTCTTGTCTCGTGTGCCTAATTT
CACTAACACGAATTCGGCAGGCTATTGTGGCAATTCCCTGGACAAGACGAGTGCTGCTGCTCCCATCGGCGACTGCAACATGCCCTGTGGTGGCGAGCCAAGCGAGTATTGTGGTGCTGG
CAATCGTCTCGAGCTGTATTCGACCACGAGCGCACCGGCCACGCCTACACCCACGGCCACCTTGATTCATAAACGCACCGTCTCTTCATACACTCTTGTGGGCTGCTGGAGTGAAGGGAA
TGGAGTTCGCGCTCTCACTCAAGGCTTCACGGCTAGCGATAAGATGACCAACGAGGCCTGCGCGACCTTTTGCAAGAATTACAAGTACTTTGGCACTGAGTACGGAAGCGAGTGCTACTG
TGGCAGTTACCTGGCTGATGGCAGCAAGATGGCTCCCATTGAGGAATGCAATATGCCTTGCTCAGGAGATCAGTATGCGTACTGCGGTGCAAGCAGCCGTTTGGAGCTTTACCAAAACCC
CAGCATCACCACTGGGAATCCCGAGCAACCAGCCGCTGTCGGCGACCACGTCCTTGTTGGTTGCCAGACCGAGGGCAATGGCACGAGGGCTCTAGCGGGATCAGCGCTTGCTCAAGACAA
CATGACCAATGAAGTCTGTGCCAACTGGTGCAAGGACCACGAATACTTTGGTACTGAGTATGGACGAGAATGCTACTGCGGCAACAGTCTTGCCACGTCTTCCTTGGCGGCCCCGGCCGC
CGAGTGCAGAATGCTCTGCGCTGGCAGTAGCACTGAATACTGCGGTGCCAGCAACCGACTGTCGGTGTATAAGAAGGAGCAGGTCACCACACCGCCGCCTACCGGGCCTCGCAGCGCGGG
AAAGGATGGGAAGAATGGGAAACAAAGAATTCGCCGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAACTTCACCAGTCCTGCTGGGCCTCCTTGGCCTGGCTGGATCTGCTCTGGCTGATCCGACCTGGCCTTCGGATATCGACGAACTCGAGGAGATCATGTTCCAAATCAGCTCGTTT
CGATCTCGCAAGTTTGCTGATACAGTGAACCCTTGCACCACCGAAGCCTCGGGTCCGGGTCGACGCAATGCCGCCGAATGGTTGCGATCGGCCTTCCATGACATGTCCACTGCCAACACG
TTCTTCAAAACCGGTGGCCTCGACGCTTCCCTTCAATATGAGCTGGACAATGGCGAGAATACCGGCCCTGGACACAGAACAACCTGCAAATTCATGGCGCCCTATGTCACCACTCGCTCC
TCGTTATCGGATTTGCTCGCCATGGGAGTCTACATGTCTGTTCGCTCTTGTGGTGGTGCCGACGGTCCCAGAGTTCCGTTTCGGGCTGGCAGAAGAGATGCTACTGCTGCTGGCGCATTA
GGTGTACCCCAACCCCAAAATTCGGTTTCTACATTTCAACAACAATTCCAACGCATGGGGTTTACCACGGAGGAGATGATTCAGGTCACGGCCTGTGGTCACACTATCGGAGGCGTTCAT
CAGGAAGAGTTTCCAGACCTCATGCCTGCCACTGGCGCGGTCAATGGCAATGTTTCATTTGATACAACCGACGCAGTTTTCGACAATAAAGTCGTTACCGAGTATCTTGGTGGCAACACC
ACCAACCCTCTCGTCGTGGGCATATCGGTCAAGCACAATAAGAATTCGGATTTCAAGATTTACAACGCGGATGGCAACAAGACCATGTCGACTCTGGCCGACGCCAGCACGTTCAAGACT
GTCTGTCAGAAGGTCTTGCAGAAGATGATTGATGTCGTTCCTCCTGGTGTTGCCCTAAGCGAGCCTGTGGTTCCATATACCGTCAAGCCTGTCAATTTGCAGCTTACTCTCACCAATGGA
GGATCCGCCCTGCAATTCTCGGGGTACATTCGAGTCAAAGCAACTGGCCTCGCAGATGGCGCCATCAGGAGCGTCACACTCACGTACAGAGATCGCAGGGGCTCCACCGACTGCGGCTCC
AGCTCTTGCAGCATCACGAGCACCATACAGGGAGCCGGCAAGGGTTTTGATGACATCTTCAACTTCTACCCGATCGAAGCTGTTATTCCTGCCTCGACTGGCATCTCATCTTTCACTGTG
ACTGTCAATAACAATGACGGAACGAGCAAGCTTTACGACAACAACGGCAAGGGATATCCCCTCCAGGACGACGTCTTGTTCCAAACACCCCAAAGCTGCATCAAGGGCACCTCGGGTGCT
CTCACTGTTGTCGCTGCTGTCCGCAACGATGTGGCTGGCAAAGGCGCCCAGGCCCACATCTCATACAAAGTTCCTCAAGACAACAAAAGTCCCGTCGCTCTCCTTCAGAATGCCACCATT
GCCCTGGTCAAGGGTGCTTGCATTGGCAAGTATACACTGTTCTCGGCCGACTACACAATCCCGGGTGGCTTGGCATACGAGTCCCGCGTTGATGTCCTCGCTGGAGATAAGGCAGATAGT
TTCAAGGCCCTGACCGGTATCGGCGGGACATGTACTCCGTTTCCAAATGCTGGAGCTTGTGACGGTGGAGAGCCTTCTACCACCAGGAGCACAACTTCTGGTGCAGCTGTTGTGGTCCCA
AGTCACCGTGCTACTGTTGGCGGCTACAAGCATTTGTCTTGCTGGACTGAAGGTGTTTCTCTGCGCGCCTTGGACGGCATCTCTTTTGTCAACGACACAATGACTCTTGAGAAGTGTGCC
GAATACTGCCGTTCCTTTGTGTACTGGGGTACCGAGTATGGTCGTGAAT
GCTATTGTGGCAATTCCCTGGACAAGACGAGTGCTGCTGCTCCCATCGGCGACTGCAACATGCCCTGTGGT
GGCGAGCCAAGCGAGTATTGTGGTGCTGGCAATCGTCTCGAGCTGTATTCGACCACGAGCGCACCGGCCACGCCTACACCCACGGCCACCTTGATTCATAAACGCACCGTCTCTTCATAC
ACTCTTGTGGGCTGCTGGAGTGAAGGGAATGGAGTTCGCGCTCTCACTCAAGGCTTCACGGCTAGCGATAAGATGACCAACGAGGCCTGCGCGACCTTTTGCAAGAATTACAAGTACTTT
GGCACTGAGTACGGAAGCGAGTGCTACTGTGGCAGTTACCTGGCTGATGGCAGCAAGATGGCTCCCATTGAGGAATGCAATATGCCTTGCTCAGGAGATCAGTATGCGTACTGCGGTGCA
AGCAGCCGTTTGGAGCTTTACCAAAACCCCAGCATCACCACTGGGAATCCCGAGCAACCAGCCGCTGTCGGCGACCACGTCCTTGTTGGTTGCCAGACCGAGGGCAATGGCACGAGGGCT
CTAGCGGGATCAGCGCTTGCTCAAGACAACATGACCAATGAAGTCTGTGCCAACTGGTGCAAGGACCACGAATACTTTGGTACTGAGTATGGACGAGAATGCTACTGCGGCAACAGTCTT
GCCACGTCTTCCTTGGCGGCCCCGGCCGCCGAGTGCAGAATGCTCTGCGCTGGCAGTAGCACTGAATACTGCGGTGCCAGCAACCGACTGTCGGTGTATAAGAAGGAGCAGGTCACCACA
CCGCCGCCTACCGGGCCTCGCAGCGCGGGAAAGGATGGGAAGAATGGGAAACAAAGAATTCGCCGTTGA

Retrieve as FASTA