Entry information : PterAPx-CcP01
Entry ID 10598
Creation 2012-02-29 (Marcel Zamocky)
Last sequence changes 2012-02-29 (Marcel Zamocky)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PterAPx-CcP01
Name PterAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Pyrenophora
Organism Pyrenophora teres    [TaxId: 53485 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PterAPx-CcP01
start..stop
S start..stop
PtritAPx-CcP01 929 0 1..527 1..526
ClunAPx-CcP01 802 0 16..527 17..529
COsaAPx-CcP01 786 0 13..527 14..530
CheAPx-CcP01_C4 776 0 13..527 14..530
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 36379..36766 388 N° 2 35123..36318 1196  
complement(join(35123..36318,36379..36766))


exon

Literature and cross-references PterAPx-CcP01
Literature Ellwood S.R., Liu Z., Syme R.A., Lai Z., Hane J.K., Keiper F., Moffat C.S., Oliver R.P., Friesen T.L. (2010)A first genome assembly of the barley fungal pathogen Pyrenophora teres f. teres. Genome Biol. 11: R109.1-R109.14
Protein ref. GenBank:   EFQ87736.1 UniProtKB:   E3S2R8
DNA ref. JGI genome:   193093 (36766..35123)
Protein sequence: PterAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   527 (508)
PWM (Da):   %s   55713.36 (53601.2)  
PI (pH):   %s   4.52 (4.48) Peptide Signal:   %s   cut: 20 range:20-527
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLRTLPIFLTLTISQQANAALYHPTLQTSLLEHILVDNWGAYASNFSSAITPCDRYVTQTGTAALTSGRTTAAQWMRVMFHDFITANVSAGTGGLDASIGFETAREENKGSAFNDSFTFWRPFVNGAVSMADLIALGTVMSNNLCGGAQMPYRAGRIDALTAGSTTGVPAPETSLEETLTFFERAGFNAQDAIGLTACGHTMGSVHHGGFPDVVDASFVTPNNTNGGSNFDTSRAVFDTKVVGEYVHWTGNKGGPLVTSYNDSMNSDLRLYESDGNATMRELLGQGDGFLDTCVELMRRAIDTVPGGVQLGKEIAAMAVKPVNVTFDFDGEGKLVLSGRMRVLTAAGEERPRSLQLHLSDDEDGLEIAAEVETGQSVFGRGSGGYGVTTYFPFSVSGASTRNVTSFSVSGSGVQQTFPISSQSFVVPSLTSLERTSLNVTVAISASSSCDDLTVHIAAPFPQLGTLAPKMREDHISMSAAEKEFDGYKLCMGTELLDKSPTGLLIVEALIRETIVDSLLVNGGMAGW

Retrieve as FASTA  
Remarks Complete sequence from genomic 1 intron, unplaced genomic scaffold. Strain="0-1"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTACGCACTCTCCCCATCTTCCTCACCCTCACCATCTCTCAACAAGCCAATGCGGCCCTCTACCACCCCACCCTCCAAACCTCCCTCCTCGAACACATTCTCGTCGACAACTGGGGC
GCCTACGCCTCAAACTTCTCCTCTGCAATTACGCCATGCGACCGCTACGTAACGCAAACCGGCACCGCCGCTCTAACCAGCGGCCGCACAACCGCCGCACAATGGATGCGCGTCATGTTC
CACGATTTCATCACGGCGAACGTGAGCGCGGGCACAGGTGGTTTGGATGCGAGTATCGGGTTTGAGACGGCGCGGGAAGAAAACAAGGGCAGTGCGTTTAATGATAGTTTTACGTTTTGG
AGACCATTTGTCAATGGGGCTGTGTCCA
GTACGTCCATGTATAATTTACCCTCCAAAGCGTGCAAGTAAACTGATGAAGACAATCAAGTGGCCGATCTCATCGCCCTAGGAACAGTAATG
TCCAACAACCTCTGCGGCGGCGCACAAATGCCGTACCGCGCCGGGCGCATCGACGCACTCACCGCAGGCTCCACAACCGGTGTTCCCGCGCCGGAAACGTCCCTCGAGGAAACTCTCACC
TTTTTCGAGCGCGCGGGCTTCAACGCTCAAGATGCCATTGGTTTGACTGCTTGCGGTCACACAATGGGCTCTGTACACCACGGCGGCTTTCCCGATGTCGTAGATGCCTCGTTTGTAACG
CCGAATAATACAAACGGCGGGAGTAACTTTGATACGTCTCGTGCTGTGTTCGATACAAAAGTCGTGGGTGAATATGTGCATTGGACGGGGAATAAAGGTGGACCGTTGGTCACGTCGTAT
AACGATAGTATGAATTCTGATCTCCGGCTGTATGAGAGCGATGGTAATGCTACTATGCGCGAATTGTTGGGGCAGGGAGACGGGTTTTTGGATACGTGTGTGGAGCTTATGCGGAGGGCG
ATTGATACTGTACCGGGTGGTGTGCAGCTAGGGAAAGAGATTGCGGCTATGGCTGTGAAGCCGGTTAATGTGACGTTTGACTTTGATGGGGAGGGGAAATTGGTGCTTTCGGGGAGGATG
AGAGTGTTGACTGCGGCGGGAGAGGAGAGACCAAGATCACTTCAGCTTCATTTGAGCGACGATGAGGACGGCCTGGAGATTGCTGCTGAAGTAGAGACAGGTCAGTCTGTGTTTGGTCGT
GGGAGTGGCGGGTATGGGGTTACGACGTATTTTCCCTTTTCGGTCTCTGGAGCCTCGACGAGGAATGTTACATCCTTCTCTGTGAGTGGCTCGGGCGTACAGCAAACGTTCCCTATTAGC
AGCCAGAGTTTCGTTGTACCAAGCCTGACCTCCCTGGAGAGAACGTCGCTCAACGTTACGGTTGCGATCTCGGCATCGAGCTCTTGCGACGATTTGACGGTACACATTGCCGCGCCATTT
CCGCAACTAGGAACTCTGGCGCCGAAGATGAGAGAAGATCATATTTCGATGAGCGCGGCTGAGAAAGAGTTTGACGGGTACAAGCTTTGTATGGGTACCGAACTCTTGGACAAGTCGCCA
ACAGGCTTGCTCATTGTCGAAGCTTTGATAAGAGAAACGATAGTTGATTCACTGTTAGTAAATGGAGGAATGGCGGGATGGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTACGCACTCTCCCCATCTTCCTCACCCTCACCATCTCTCAACAAGCCAATGCGGCCCTCTACCACCCCACCCTCCAAACCTCCCTCCTCGAACACATTCTCGTCGACAACTGGGGC
GCCTACGCCTCAAACTTCTCCTCTGCAATTACGCCATGCGACCGCTACGTAACGCAAACCGGCACCGCCGCTCTAACCAGCGGCCGCACAACCGCCGCACAATGGATGCGCGTCATGTTC
CACGATTTCATCACGGCGAACGTGAGCGCGGGCACAGGTGGTTTGGATGCGAGTATCGGGTTTGAGACGGCGCGGGAAGAAAACAAGGGCAGTGCGTTTAATGATAGTTTTACGTTTTGG
AGACCATTTGTCAATGGGGCTGTGTCCA
TGGCCGATCTCATCGCCCTAGGAACAGTAATGTCCAACAACCTCTGCGGCGGCGCACAAATGCCGTACCGCGCCGGGCGCATCGACGCACTC
ACCGCAGGCTCCACAACCGGTGTTCCCGCGCCGGAAACGTCCCTCGAGGAAACTCTCACCTTTTTCGAGCGCGCGGGCTTCAACGCTCAAGATGCCATTGGTTTGACTGCTTGCGGTCAC
ACAATGGGCTCTGTACACCACGGCGGCTTTCCCGATGTCGTAGATGCCTCGTTTGTAACGCCGAATAATACAAACGGCGGGAGTAACTTTGATACGTCTCGTGCTGTGTTCGATACAAAA
GTCGTGGGTGAATATGTGCATTGGACGGGGAATAAAGGTGGACCGTTGGTCACGTCGTATAACGATAGTATGAATTCTGATCTCCGGCTGTATGAGAGCGATGGTAATGCTACTATGCGC
GAATTGTTGGGGCAGGGAGACGGGTTTTTGGATACGTGTGTGGAGCTTATGCGGAGGGCGATTGATACTGTACCGGGTGGTGTGCAGCTAGGGAAAGAGATTGCGGCTATGGCTGTGAAG
CCGGTTAATGTGACGTTTGACTTTGATGGGGAGGGGAAATTGGTGCTTTCGGGGAGGATGAGAGTGTTGACTGCGGCGGGAGAGGAGAGACCAAGATCACTTCAGCTTCATTTGAGCGAC
GATGAGGACGGCCTGGAGATTGCTGCTGAAGTAGAGACAGGTCAGTCTGTGTTTGGTCGTGGGAGTGGCGGGTATGGGGTTACGACGTATTTTCCCTTTTCGGTCTCTGGAGCCTCGACG
AGGAATGTTACATCCTTCTCTGTGAGTGGCTCGGGCGTACAGCAAACGTTCCCTATTAGCAGCCAGAGTTTCGTTGTACCAAGCCTGACCTCCCTGGAGAGAACGTCGCTCAACGTTACG
GTTGCGATCTCGGCATCGAGCTCTTGCGACGATTTGACGGTACACATTGCCGCGCCATTTCCGCAACTAGGAACTCTGGCGCCGAAGATGAGAGAAGATCATATTTCGATGAGCGCGGCT
GAGAAAGAGTTTGACGGGTACAAGCTTTGTATGGGTACCGAACTCTTGGACAAGTCGCCAACAGGCTTGCTCATTGTCGAAGCTTTGATAAGAGAAACGATAGTTGATTCACTGTTAGTA
AATGGAGGAATGGCGGGATGGTAA

Retrieve as FASTA