Entry information : PnoAPx-CcP02
Entry ID 10600
Creation 2012-02-29 (Marcel Zamocky)
Last sequence changes 2012-02-29 (Marcel Zamocky)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PnoAPx-CcP02
Name PnoAPx-CcP02
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoAPx-CcP02
start..stop
S start..stop
Ssrc1lsm3aAPx-CcP01 494 5e-175 1..303 1..321
CheAPx-CcP01_C4 473 1e-166 9..303 11..324
COsaAPx-CcP01 473 1e-166 9..303 11..324
ClunAPx-CcP01 473 2e-166 16..304 18..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 371668..372052 385 N° 2 372102..372280 179 N° 3 372380..372799 420  
join(371668..372052,372102..372280,372380..372799)


exon

Literature and cross-references PnoAPx-CcP02
Literature Hane J.K. et al. (2007) Plant Cell 19:3347-3368
Protein ref. GenBank:   EAT78001.1 UniProtKB:   Q0U0U6
DNA ref. JGI genome:   scaffold_33 (371668..372799)
Protein sequence: PnoAPx-CcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (309)
PWM (Da):   %s   35058.25 (33291.2)  
PI (pH):   %s   4.94 (4.70) Peptide Signal:   %s   cut: 19 range:19-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLLSAKVIIASLLAGSKAAFYYPDVQTHLLEHILVDNWGTYASNFSSAITPCTNYVTQIGTAALNSGRTTAAQWMRVLFHDFVTANVSAGTGGVDASIGFETARSENSGSAFNDSFTFWRPFVNNAVSMADLVALGTAMSNNLCGGRNIPYRAGRIDATSAGSTTGVPAPETDLEETLVFFERAGFDGGFPDVVEEIAVTPNNTNGGSNFDSTRGAFDPAVLGEYLHGTGKRGGPLVTSNNVTTRSDLRLYESDQNATMQALFAQGDTFLDTCVGLFNRMMNTVPTGVQLGPVIEALAVKPMQRYLRLRCTWEVEAVRQVQNTHWG*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Strain="SN15".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTCTGTCTGCGAAAGTCATTATTGCATCCCTGCTGGCCGGGTCCAAAGCGGCCTTCTATTACCCAGACGTGCAAACGCATCTTCTCGAGCATATCCTGGTTGACAATTGGGGTACA
TATGCTTCAAACTTTTCTTCTGCCATCACCCCTTGCACAAACTATGTCACGCAAATAGGAACCGCCGCGCTTAATAGTGGCCGCACGACCGCCGCACAATGGATGCGAGTTCTGTTTCAT
GACTTTGTCACCGCAAATGTCAGTGCAGGAACTGGCGGTGTCGATGCGAGCATTGGTTTCGAAACCGCACGCAGCGAGAACTCTGGTAGTGCATTCAACGATAGTTTCACATTCTGGCGC
CCGTTTGTGAACAATGCAGTGTCCA
GTAAGCAAGTCCAACCGGGAGATGGGGTGAGGTGCTGATCGAGTCGCAGTGGCTGATCTCGTTGCCCTCGGAACCGCCATGTCCAACAATCTTTG
CGGTGGTCGAAATATTCCCTATCGTGCTGGCCGTATTGATGCTACATCAGCAGGCTCTACGACTGGCGTACCCGCTCCAGAGACCGACCTGGAGGAAACCTTGGTCTTTTTTGAGCGCGC
AGGCTTCGACAAA
GTAGATTCCATAGGTTTGACTGCATGTGGGCATACCATGGGATCTGTGCATCATGTTGGTAAGCTTCAACAATACGGCTTCTTTTACTAACCATCCCAGGGAGGGTT
CCCTGATGTGGTCGAGGAGATTGCCGTCACGCCCAACAACACAAATGGTGGCAGCAACTTCGATAGCACGCGTGGCGCTTTTGACCCGGCAGTATTGGGCGAGTATCTCCACGGAACGGG
GAAGAGAGGCGGACCGCTGGTGACATCGAACAACGTTACCACTCGTTCAGATCTCCGACTTTACGAGAGTGACCAAAATGCAACTATGCAAGCTTTATTTGCTCAAGGAGATACCTTCCT
GGACACCTGTGTCGGTTTGTTCAATCGCATGATGAACACGGTCCCCACAGGAGTACAACTCGGACCTGTCATCGAAGCCTTAGCCGTCAAGCCAATGCAACGTTACCTTCGACTTCGATG
CACATGGGAAGTTGAAGCTGTCCGGCAAGTTCAGAATACTCACTGGGGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTCTGTCTGCGAAAGTCATTATTGCATCCCTGCTGGCCGGGTCCAAAGCGGCCTTCTATTACCCAGACGTGCAAACGCATCTTCTCGAGCATATCCTGGTTGACAATTGGGGTACA
TATGCTTCAAACTTTTCTTCTGCCATCACCCCTTGCACAAACTATGTCACGCAAATAGGAACCGCCGCGCTTAATAGTGGCCGCACGACCGCCGCACAATGGATGCGAGTTCTGTTTCAT
GACTTTGTCACCGCAAATGTCAGTGCAGGAACTGGCGGTGTCGATGCGAGCATTGGTTTCGAAACCGCACGCAGCGAGAACTCTGGTAGTGCATTCAACGATAGTTTCACATTCTGGCGC
CCGTTTGTGAACAATGCAGTGTCCA
TGGCTGATCTCGTTGCCCTCGGAACCGCCATGTCCAACAATCTTTGCGGTGGTCGAAATATTCCCTATCGTGCTGGCCGTATTGATGCTACATCA
GCAGGCTCTACGACTGGCGTACCCGCTCCAGAGACCGACCTGGAGGAAACCTTGGTCTTTTTTGAGCGCGCAGGCTTCGACAAA
GGAGGGTTCCCTGATGTGGTCGAGGAGATTGCCGTC
ACGCCCAACAACACAAATGGTGGCAGCAACTTCGATAGCACGCGTGGCGCTTTTGACCCGGCAGTATTGGGCGAGTATCTCCACGGAACGGGGAAGAGAGGCGGACCGCTGGTGACATCG
AACAACGTTACCACTCGTTCAGATCTCCGACTTTACGAGAGTGACCAAAATGCAACTATGCAAGCTTTATTTGCTCAAGGAGATACCTTCCTGGACACCTGTGTCGGTTTGTTCAATCGC
ATGATGAACACGGTCCCCACAGGAGTACAACTCGGACCTGTCATCGAAGCCTTAGCCGTCAAGCCAATGCAACGTTACCTTCGACTTCGATGCACATGGGAAGTTGAAGCTGTCCGGCAA
GTTCAGAATACTCACTGGGGCTGA

Retrieve as FASTA