Entry information : VdaAPx-CcP01
Entry ID 10602
Creation 2012-02-29 (Marcel Zamocky)
Last sequence changes 2012-02-29 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-04-10 (Christophe Dunand)
Peroxidase information: VdaAPx-CcP01
Name VdaAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Verticillium
Organism Verticillium dahliae    [TaxId: 27337 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value VdaAPx-CcP01
start..stop
S start..stop
VaaAPx-CcP02 1323 0 17..735 17..733
VaaAPx-CcP02 165 3e-42 801..963 566..731
VaaAPx-CcP02 118 2e-27 672..854 559..731
VaaAPx-CcP02 101 3e-22 913..1003 568..658
AalcAPx-CcP 1256 0 15..1001 18..1037
AalcAPx-CcP 248 8e-69 674..1004 578..927
AalcAPx-CcP 237 6e-65 563..901 697..1046
CgraAPx-CcP 1133 0 17..1004 20..1062
CgraAPx-CcP 183 1e-47 777..1008 552..786
StheAPx-CcP01 1037 0 1..1001 1..1049
StheAPx-CcP01 253 4e-70 564..893 708..1050
StheAPx-CcP01 206 9e-55 800..1008 595..808
StheAPx-CcP01 166 3e-42 563..754 835..1050
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1922310..1924486 2177 N° 2 1921361..1922185 825 N° 3 1921157..1921220 64  
complement(join(1921157..1921220,1921361..1922185,1922310..1924486))


exon

Literature and cross-references VdaAPx-CcP01
Protein ref. UniProtKB:   G2WUH6
DNA ref. JGI genome:   Supercontig_1.2 (1924486..1921157)
Protein sequence: VdaAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1021 (1004)
PWM (Da):   %s   106754.13 (105046.1)  
PI (pH):   %s   4.95 (4.90) Peptide Signal:   %s   cut: 18 range:18-1021
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLQAALLVALLGLTTADPTWPAETDELEEIMFQTTSTRSRKFADSVSPCTNQPSGPGRHNAAEWLRTAFHDMATANTARGTGGIDASLQYELNNGENTGPGFGTTLTFMSPYMTKKSSMADLIALGVYISVRACGGPAVPFRAGRRDATTAGAVGVPQPQNAISIFRTQFDRMGFSPQEMIQVTACGHTIGGVHSAEFPDIIPAGTATNGQIALDSSVAVFDNKIVTEYLDGTTQNPLVVGRAVGLNKHSDFKVYNSDRNVTMQAMASAAAFNEVCKTVLQKMIDVVPPSVTLTAPLEPYQVKPVGLQLTLSTQGTVIELTGFIRIRTTNVPLTSIAGLTINYKARNGGNDCGSSGCSFPLTVQGVGRGLDDSFAWFPIARNVPLASGISSFTVTERRTDGTSTVYDNNGASYPIQDAVFLQRYQSCLLQSSGVTTLTAAVRNDRAELPVRAIVSYKTTQTGSVVPALNTLTLELTRGPCIGPYTLFSASTTIPGGRSVEATFDILSGDRVDAFKKANILGGTCQSRPVSNVCNTPVITSAVPSATSTTMTTISSPAPSIYRRQTMGSYTLVSCWSEPPAARALTGASFAYDGMTLDSCLSNCTGFNYWGTEYGRECYCGDALHSGSAAAPLADCGMPCSGDGTQYCGGGNRIELYRTTATKTSTSTTAAPGPTRVPSVGRFVRVGCQTDNTGARALSGATTAGDDMTLDKCAAFCSAFNYFGTDPAPVEECNMRCAGNPLQFCGDGNRLELYRASAASSATLASSTAATTGGAESSVRLSEATSSSSAPSPTGPSPVPTVSPFTLVGCQAEATSVPRALSAKSTTSNSMTLADCAAFCTGYRYFGTEYAAECYCGNSLHASSSVAPLDDCAMPCAGDPLTHCGGPNRLTLYEDPARASTPPREPRQPAFAGDFVWFGCRTEPAGARALSGKERAADDMTNESCAAFCEGFAMFGTEYGRECFCGDELHAGAAEAPEEQCSMLCAGADDEFCGNGNRLSVAKHMAASCPSEILELNGVEG

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). Peroxidase domain fused to 4 WSC domains (putative carbohydrate binding domain). Strain="VdLs.17".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTTCAAGCAGCCCTGTTGGTGGCCCTTCTCGGCCTCACCACTGCAGACCCGACTTGGCCCGCTGAGACGGATGAGCTTGAGGAGATCATGTTCCAGACGACGAGCACTCGCTCC
CGCAAGTTTGCTGATTCGGTCTCCCCTTGCACCAACCAGCCATCCGGCCCCGGCCGTCACAACGCTGCCGAGTGGCTCCGCACCGCTTTTCATGACATGGCCACCGCCAATACGGCCCGT
GGTACTGGTGGTATCGACGCTTCCCTCCAGTACGAGCTCAACAACGGCGAGAATACCGGTCCTGGGTTCGGCACGACCCTCACCTTCATGAGCCCCTACATGACCAAGAAGAGTTCCATG
GCCGACCTCATTGCCCTCGGCGTCTACATATCCGTAAGAGCGTGCGGCGGCCCCGCCGTTCCCTTCCGCGCCGGCAGGAGAGATGCCACGACCGCCGGTGCCGTGGGCGTACCCCAACCG
CAGAACGCCATCAGTATCTTCCGGACACAGTTTGACCGCATGGGCTTCTCGCCACAAGAGATGATTCAGGTGACCGCGTGTGGCCATACCATTGGCGGCGTGCACTCGGCCGAGTTTCCA
GATATCATCCCAGCGGGCACCGCAACGAACGGGCAGATTGCCCTCGACTCGAGCGTCGCCGTCTTTGACAACAAGATTGTCACTGAGTACCTCGATGGCACGACCCAGAACCCGCTCGTC
GTGGGCCGTGCCGTCGGCCTCAACAAGCACTCCGACTTCAAGGTGTACAACTCGGATCGCAATGTCACCATGCAGGCCATGGCCTCGGCTGCCGCCTTCAACGAAGTCTGCAAGACGGTG
CTGCAGAAGATGATCGACGTCGTGCCTCCCAGCGTCACCCTAACGGCACCTCTTGAGCCGTACCAGGTCAAGCCCGTCGGCCTGCAGCTGACGCTCTCTACGCAAGGCACCGTCATCGAG
CTGACAGGTTTCATCCGCATCCGCACCACCAATGTGCCACTTACCTCTATTGCAGGCCTGACCATCAATTACAAGGCACGCAACGGCGGCAACGACTGCGGATCAAGCGGCTGCTCATTT
CCTCTTACTGTCCAAGGCGTCGGCCGCGGCCTCGACGACTCGTTCGCGTGGTTTCCCATCGCCCGTAATGTACCGCTCGCTAGTGGCATCTCCTCTTTCACCGTCACAGAGCGCCGCACA
GATGGCACAAGTACAGTCTACGACAACAACGGCGCCTCATATCCCATCCAGGACGCCGTCTTTCTGCAACGCTATCAGAGCTGCCTTCTGCAGTCATCCGGCGTGACGACTCTCACAGCC
GCAGTCCGCAACGACCGTGCCGAGTTGCCCGTCCGCGCCATCGTATCCTACAAGACAACCCAGACCGGTAGCGTCGTGCCTGCCCTCAATACCCTGACGCTCGAACTGACCCGCGGCCCT
TGCATCGGCCCCTATACACTATTTTCGGCATCGACCACCATACCTGGCGGCCGTAGCGTTGAGGCTACTTTTGATATTCTTAGCGGCGACCGCGTCGACGCCTTCAAGAAGGCCAATATC
CTCGGCGGGACATGCCAGTCTCGGCCTGTCAGTAACGTCTGCAACACACCAGTCATTACCTCCGCCGTGCCTTCGGCCACCTCTACCACCATGACGACGATATCCTCGCCCGCGCCTTCG
ATATACCGCCGCCAGACGATGGGCTCCTATACTCTTGTCTCCTGCTGGTCCGAGCCTCCTGCCGCCCGCGCCCTGACTGGCGCCTCCTTCGCCTATGACGGCATGACTCTCGACTCCTGC
CTATCCAACTGCACCGGCTTCAACTACTGGGGAACTGAATACGGTCGCGAGTGCTACTGCGGCGACGCCCTCCACTCTGGGAGCGCCGCGGCACCACTTGCGGACTGCGGCATGCCTTGC
TCCGGCGACGGGACGCAATACTGCGGAGGCGGCAACAGGATCGAGCTTTACCGGACAACAGCCACAAAGACAAGCACGAGCACAACCGCCGCTCCTGGGCCGACGCGTGTGCCGAGTGTT
GGCAGATTCGTGCGTGTGGGATGCCAGACAGACAATACGGGCGCCAGGGCTCTGAGCGGCGCCACGACAGCAGGGGATGATATGACACTGGACAAGTGTGCTGCTTTCTGCTCCGCATTC
AACTACTTTGGCACGGA
GTATGGCAGAGAATGTGAGTTGGTCCCCTTGTCCCACCGTCGCCGGATTCACGTCTTGCTTTTAACCGATCAATAATACTAATTCTTCAGGCTGGTGTGGCAA
TGCTCTTGACTCGTTGAGCAGTCCCGCGCCCGTAGAGGAGTGCAATATGAGGTGTGCAGGGAACCCTCTTCAGTTCTGCGGCGACGGGAACCGTCTCGAGCTGTACCGGGCAAGTGCTGC
ATCGTCAGCAACGCTCGCAAGTTCAACCGCCGCCACCACGGGCGGCGCTGAGTCGAGCGTCAGGCTCAGCGAGGCCACGTCTTCTTCGAGTGCTCCATCACCCACCGGCCCTTCGCCCGT
TCCGACAGTTTCGCCCTTCACACTCGTCGGCTGCCAGGCAGAAGCGACGTCTGTCCCGCGTGCCCTGTCGGCAAAGTCGACGACGTCCAACTCGATGACCCTGGCCGACTGCGCTGCATT
CTGTACGGGTTACCGCTACTTCGGCACAGAGTACGCGGCCGAGTGCTACTGCGGCAATTCTCTCCATGCCTCCTCCTCCGTCGCGCCCCTCGACGACTGCGCCATGCCATGCGCCGGCGA
CCCGCTCACGCACTGCGGCGGGCCCAACCGCCTCACCCTCTACGAGGACCCGGCTCGCGCCTCGACGCCGCCTCGCGAGCCCCGCCAGCCTGCATTTGCGGGCGACTTTGTCTGGTTTGG
GTGCCGTACCGAACCGGCGGGGGCCCGCGCGCTGTCGGGCAAGGAGCGCGCGGCGGACGACATGACGAACGAGTCGTGCGCCGCGTTTTGCGAGGGCTTCGCCATGTTCGGCACCGAGTA
CGGGCGCGAGTGCTTCTGCGGCGACGAGCTGCACGCCGGGGCCGCCGAGGCGCCCGAGGAGCAGTGCAGCATGCTCTGCGCGGGGGCGGACGACGAATTCTGCGGCAACGGCAACAGGCT
CTCCGT
GTATGTGAGGCAGGAGGACGAGGCATGATAGGAGATCCGAGGCTGAGGGCTGCACCCTTGGGGGTGTCCCCCTGGTAGCGGTGCGTCTTTTGCGTACGAGTAGTCTAGCATACT
TCGAGGACTGACCAAGTCTCTTCAAGTGCAAAGCACATGGCTGCATCTTGCCCCTCCGAGATTTTGGAGTTGAATGGAGTTGAAGGGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTTCAAGCAGCCCTGTTGGTGGCCCTTCTCGGCCTCACCACTGCAGACCCGACTTGGCCCGCTGAGACGGATGAGCTTGAGGAGATCATGTTCCAGACGACGAGCACTCGCTCC
CGCAAGTTTGCTGATTCGGTCTCCCCTTGCACCAACCAGCCATCCGGCCCCGGCCGTCACAACGCTGCCGAGTGGCTCCGCACCGCTTTTCATGACATGGCCACCGCCAATACGGCCCGT
GGTACTGGTGGTATCGACGCTTCCCTCCAGTACGAGCTCAACAACGGCGAGAATACCGGTCCTGGGTTCGGCACGACCCTCACCTTCATGAGCCCCTACATGACCAAGAAGAGTTCCATG
GCCGACCTCATTGCCCTCGGCGTCTACATATCCGTAAGAGCGTGCGGCGGCCCCGCCGTTCCCTTCCGCGCCGGCAGGAGAGATGCCACGACCGCCGGTGCCGTGGGCGTACCCCAACCG
CAGAACGCCATCAGTATCTTCCGGACACAGTTTGACCGCATGGGCTTCTCGCCACAAGAGATGATTCAGGTGACCGCGTGTGGCCATACCATTGGCGGCGTGCACTCGGCCGAGTTTCCA
GATATCATCCCAGCGGGCACCGCAACGAACGGGCAGATTGCCCTCGACTCGAGCGTCGCCGTCTTTGACAACAAGATTGTCACTGAGTACCTCGATGGCACGACCCAGAACCCGCTCGTC
GTGGGCCGTGCCGTCGGCCTCAACAAGCACTCCGACTTCAAGGTGTACAACTCGGATCGCAATGTCACCATGCAGGCCATGGCCTCGGCTGCCGCCTTCAACGAAGTCTGCAAGACGGTG
CTGCAGAAGATGATCGACGTCGTGCCTCCCAGCGTCACCCTAACGGCACCTCTTGAGCCGTACCAGGTCAAGCCCGTCGGCCTGCAGCTGACGCTCTCTACGCAAGGCACCGTCATCGAG
CTGACAGGTTTCATCCGCATCCGCACCACCAATGTGCCACTTACCTCTATTGCAGGCCTGACCATCAATTACAAGGCACGCAACGGCGGCAACGACTGCGGATCAAGCGGCTGCTCATTT
CCTCTTACTGTCCAAGGCGTCGGCCGCGGCCTCGACGACTCGTTCGCGTGGTTTCCCATCGCCCGTAATGTACCGCTCGCTAGTGGCATCTCCTCTTTCACCGTCACAGAGCGCCGCACA
GATGGCACAAGTACAGTCTACGACAACAACGGCGCCTCATATCCCATCCAGGACGCCGTCTTTCTGCAACGCTATCAGAGCTGCCTTCTGCAGTCATCCGGCGTGACGACTCTCACAGCC
GCAGTCCGCAACGACCGTGCCGAGTTGCCCGTCCGCGCCATCGTATCCTACAAGACAACCCAGACCGGTAGCGTCGTGCCTGCCCTCAATACCCTGACGCTCGAACTGACCCGCGGCCCT
TGCATCGGCCCCTATACACTATTTTCGGCATCGACCACCATACCTGGCGGCCGTAGCGTTGAGGCTACTTTTGATATTCTTAGCGGCGACCGCGTCGACGCCTTCAAGAAGGCCAATATC
CTCGGCGGGACATGCCAGTCTCGGCCTGTCAGTAACGTCTGCAACACACCAGTCATTACCTCCGCCGTGCCTTCGGCCACCTCTACCACCATGACGACGATATCCTCGCCCGCGCCTTCG
ATATACCGCCGCCAGACGATGGGCTCCTATACTCTTGTCTCCTGCTGGTCCGAGCCTCCTGCCGCCCGCGCCCTGACTGGCGCCTCCTTCGCCTATGACGGCATGACTCTCGACTCCTGC
CTATCCAACTGCACCGGCTTCAACTACTGGGGAACTGAATACGGTCGCGAGTGCTACTGCGGCGACGCCCTCCACTCTGGGAGCGCCGCGGCACCACTTGCGGACTGCGGCATGCCTTGC
TCCGGCGACGGGACGCAATACTGCGGAGGCGGCAACAGGATCGAGCTTTACCGGACAACAGCCACAAAGACAAGCACGAGCACAACCGCCGCTCCTGGGCCGACGCGTGTGCCGAGTGTT
GGCAGATTCGTGCGTGTGGGATGCCAGACAGACAATACGGGCGCCAGGGCTCTGAGCGGCGCCACGACAGCAGGGGATGATATGACACTGGACAAGTGTGCTGCTTTCTGCTCCGCATTC
AACTACTTTGGCACGGA
TCCCGCGCCCGTAGAGGAGTGCAATATGAGGTGTGCAGGGAACCCTCTTCAGTTCTGCGGCGACGGGAACCGTCTCGAGCTGTACCGGGCAAGTGCTGCATCG
TCAGCAACGCTCGCAAGTTCAACCGCCGCCACCACGGGCGGCGCTGAGTCGAGCGTCAGGCTCAGCGAGGCCACGTCTTCTTCGAGTGCTCCATCACCCACCGGCCCTTCGCCCGTTCCG
ACAGTTTCGCCCTTCACACTCGTCGGCTGCCAGGCAGAAGCGACGTCTGTCCCGCGTGCCCTGTCGGCAAAGTCGACGACGTCCAACTCGATGACCCTGGCCGACTGCGCTGCATTCTGT
ACGGGTTACCGCTACTTCGGCACAGAGTACGCGGCCGAGTGCTACTGCGGCAATTCTCTCCATGCCTCCTCCTCCGTCGCGCCCCTCGACGACTGCGCCATGCCATGCGCCGGCGACCCG
CTCACGCACTGCGGCGGGCCCAACCGCCTCACCCTCTACGAGGACCCGGCTCGCGCCTCGACGCCGCCTCGCGAGCCCCGCCAGCCTGCATTTGCGGGCGACTTTGTCTGGTTTGGGTGC
CGTACCGAACCGGCGGGGGCCCGCGCGCTGTCGGGCAAGGAGCGCGCGGCGGACGACATGACGAACGAGTCGTGCGCCGCGTTTTGCGAGGGCTTCGCCATGTTCGGCACCGAGTACGGG
CGCGAGTGCTTCTGCGGCGACGAGCTGCACGCCGGGGCCGCCGAGGCGCCCGAGGAGCAGTGCAGCATGCTCTGCGCGGGGGCGGACGACGAATTCTGCGGCAACGGCAACAGGCTCTCC
GT
TGCAAAGCACATGGCTGCATCTTGCCCCTCCGAGATTTTGGAGTTGAATGGAGTTGAAGGGTAA

Retrieve as FASTA