Entry information : EcamRboh07 (EcC054056.10)
Entry ID 10611
Creation 2012-02-29 (Qiang Li)
Last sequence changes 2013-05-23 (Li)
Sequence status partial
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EcamRboh07 (EcC054056.10)
Name (synonym) EcamRboh07 (EcC054056.10)
Class Respiratory burst oxidase homolog    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamRboh07
start..stop
S start..stop
EguRboh07 1338 0 5..683 16..694
EgrRboh07 1318 0 5..683 29..796
MtRboh06 908 0 14..683 50..815
CsRboh07 860 0 7..683 26..784
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..328 328 N° 2 1338..1494 157 N° 3 1591..1639 49 N° 4 1736..1849 114
N° 5 2069..2347 279 N° 6 2548..2934 387 N° 7 3214..3309 96 N° 8 3508..3623 116
N° 9 3768..3870 103 N° 10 3945..4109 165 N° 11 4521..4649 129 N° 12 5083..5161 79
N° 13 5439..5545 107  
join(1..328,1338..1494,1591..1639,1736..1849,2069..2347,2548..2934,3214..3309,35 08..3623,3768..3870,3945..4109,4521..4649,5083..5161,5439..5545)


exon

Literature and cross-references EcamRboh07 (EcC054056.10)
Protein sequence: EcamRboh07 (EcC054056.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   683
PWM (Da):   %s   77161.4 Transmb domain:   %s   o206-225i290-309o340-362i393-415o
PI (pH):   %s   9.05
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDSPEAHYTSSSSSSSSSSSFSSSYGASVVPVPYSPVQTDRDHRADDHDGGINGGTVAATSLAIQRLRFLDASAKHWRQVEERFDRIARDRYRNGVQPAARWSDFAFCVGIQRSTEYAQELLRALRGRDGLKSDITKSELHYFWRRLTDPCPDSKIQIFFDLCDRNMDGIVSRRDVKVILMSAAANKVSLTGEEADEYTALIMDAVGSGDRGYIEVLFRSYWRRAWIVALWLAICVALFTWKFIQYRHRTAFEVMGYCLCTAKGAAETLKFNMAVILLPVCRNTVTWLRASRRVSSIVPFNDNINFHKLIAAGIVIGVILHGGTHLACDFPRISSSDHSIFRQTIAAGFGYHQPSYLQILATTEVATGIAMVVLMAIAFSLATRWPRRQAPPLPRSVRQVTGYNTFWYSHHLFVFVYALLIVHSMFLFLTSNLIEKTTWMYIAFPVLLYTGERIFRAVRSSFYEVEILKANVYPGKVLSLTISKPEGFEYRSGMYIYIQCSRISPFEWHPFSLTSGPDEGHLSVHIRTLGDWSYQLYSLFQATVARTASYPKMYIDGPYGAASQDYVKYDVVVLVGLGIGATPFISILKDVVGCDHSIMEMHNFLTSMYKEEDARSVLLSTIQALSRAKSGIDFISQTPVHTHFARPNWSSIFSKLSRRHGGSQIGVFYCGPSALAGELEEMCTKFSTKTITRFVFHKEH

Retrieve as FASTA  
Remarks partial sequence from genomic. Incorrect prediction from kazusa. 5' end is missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCTCCCGAGGCTCATTATACATCCTCCTCCTCCTCCTCATCCTCATCCTCTTCCTTCTCGTCTTCCTACGGCGCCAGCGTGGTTCCGGTCCCGTACTCTCCCGTCCAGACGGAC
CGGGATCACCGTGCCGATGATCACGACGGCGGAATCAACGGCGGCACGGTGGCGGCAACTAGCCTGGCCATCCAGCGGCTGAGGTTCCTGGACGCGAGCGCCAAGCACTGGAGGCAGGTG
GAGGAGCGGTTCGACCGGATCGCCCGGGACCGCTACCGGAATGGCGTCCAGCCGGCGGCCAGGTGGTCGGATTTCGCCTTCTGCGTCG
GTGAGTGCTCCGGAACATAGGCAAAACGATTA
ACGGTTAACGATTAACGATTAACGATTTCTCGGCGATTCAATTAGAAAAATTAAATCAAAATACATTTTTTTTTTATATTTCATTTTCACATTTTTTGAGAGAAATTTGGATGCCATTGA
GCGTTCAACATGCGAGGTTGTAAGCGTCCATGCAAGGCGCGCTCTCGCTAACATGCGCTCCCGCCGCTACCCGGCACGTACACGGTGCTCAATGGCTGCCACGTAAGCAGGCGCACGTTA
GCACGGAAAATGCTTTTTAGATTTCAGTTTTCATCAAAGGGAAAAAAAATTAGGAAAAATACAAGAAATAAATTACAGTTTCGAACTATCGATACTTTTATTTTGAAGCGTCTAAAATCA
TTTCGACAATTTTTTCGTAACTTTTTCGTATGTTTTTCTTTCCAAATTATGCACGTGATTCACATTTCTTTTTCTGTACATGATTGGTTTCAATAATAAATTGCAAATTATCCTAAAATT
TCAAAAATATATGCATATATGAAATAATCTCATTTATGCAAAAATGGAGTCTTGAAGACATGTGATATGATGAAGCGCAAATAAAAATAACAAGTCATTTCGATAATTTTTTTAATAATT
TTTATATGTATGTCTTTTCCAAATTATTGTGATGCTTTGGTATTTAGAATTGTTCGTCAAAAAAAAAGTATGCAGGCGATTCACTTTTTGTTTTTTTTTGTTCTGTACGTGATTCATTTC
AATAACCATGGCAGCTACTGAGTATGTAGATAATAAATTGTCCTAGTCTATGCAAAAATGGAGTCTTGAAAACAAGTGATGTGACGGCGCATAAAGAAAGAATGTCAATTACGATATTTT
CCAGAAAAAAAGAACCCTAGAAATGTACTAAAATTGTATTATATGCACATATATTTTCTAATTCATATGTTGAGATTTTTTATTGAAGTGCATGGATGAGAAAAATGTGGAAAAACTTTT
GGTTTGACAATCGACAGGAATTCAACGGTCAACGGAATACGCCCAGGAGCTGCTGCGAGCGCTGCGAGGGAGAGACGGCCTCAAATCCGACATCACAAAGAGCGAACTCCACTACTTCTG
GCGCCGCCTCACCGACCCGTGCCCCGACTCCAAAATCCAGATCTTCTTCGACTT
GTAATCAATTCAAATTCATCGCCATTTCCATGAATTATTCTGTACATTTCGATCGCGGAAAATACC
CGTTTCTTCATTTTTAATTATATCGCGCAGGTGCGACCGAAATATGGATGGGATAGTTAGCCGGCGCGACGTCAAGCAGGTGCGCTGCTGCGTTCGTTTCACGGAAAATGAAAAGGGATT
TTCAGGGCACTTTAGTTTATTCTTTCTCAAGATTTCGAAACTTTGATTTGGGCAGGTGATCTTGATGAGTGCTGCCGCGAACAAGGTGAGCTTGACCGGCGAGGAGGCGGACGAGTACAC
CGCCCTGATCATGGACGCCGTCGGCTCAGGAGATCGAGGTTACATAGAG
GTGATGACGCCTTCAATGAGAGGAATGAAATGGTGGCAAAGCTCAACGTTGCCTGACTGATGTCATGACAT
GTTCACTGTGCAGATATCTCAAGTGGAGACGCTGCTGAAGCTCGGGTTGTCGAAGGACTCTTCCGCCACTGCCCCGTCGCCAAGGCTGTGCTACCGCGGGGGCTGGGACTCGGATGGGGT
GGTCGGGCGGCCCATGTCGACGCTGGAGGTCTTGTTCCGGAGCTACTGGCGACGGGCGTGGATCGTGGCCCTCTGGCTGGCGATTTGCGTTGCGCTGTTCACGTGGAAGTTCATTCAGTA
TAGGCATAGGACGGCGTTCGAGGTCATGGGCTACTGCCTTTGCACCGCCAAGGGGGCTGCCGAGACCCTCAAGTTCAACATGGCCGTGATTCTCCTCCCCGTCTGCCGGAACACAGTCAC
GTGGCTCCGCGCCAGCCGCCGGGTCAGCTCGATTGTCCCCTTCAACGATAACATCAACTTTCACAAG
GTAGAAGAGGAGTGCGTAGTAATTCATGCAATATTCTCAACATTCTACCATCA
TATACTAGCAGCATGACTGATTCCTATCAAATAAGAACCAAGCTTCGGCTTGAGATTTCAGAAACTGGTTGATTTCATAGTGTCAAGCAACGGTCATCTCCTGTCTGATGCAACTGTAAA
CACCCCGAATTCATTTATCTATGACAGTTGATCGCAGCTGGGATCGTGATCGGGGTGATCCTCCATGGTGGCACCCACTTGGCGTGCGACTTCCCTCGGATCAGTAGCTCGGATCACTCG
ATCTTCCGCCAGACGATTGCTGCAGGGTTCGGCTACCATCAGCCATCGTATCTCCAGATCCTGGCCACGACGGAGGTGGCAACAGGGATCGCAATGGTGGTCCTTATGGCAATCGCGTTC
TCCCTCGCGACAAGGTGGCCAAGGCGCCAGGCCCCGCCGCTGCCCCGGTCAGTCCGGCAGGTCACGGGGTACAACACCTTCTGGTACTCACACCACCTCTTCGTCTTCGTGTACGCACTG
TTGATCGTGCACTCCATGTTCCTCTTCCTGACCAGCAACCTAATAGAAAAGACG
GTAGGTTGCTCGGACTTTTAGATTCGTACAGAATAGTGCTGATCCGATGTCATTGTCTCGACAAAC
GTATGGATTTTTCACAACTTCACTGGAGTTCTTGCTTAGAAATTAGAAGCAGTTCTCAGCATGCATCACAATTCCCACAAGAAATGCAAGAAATTTGGAGAGCTGCAATTTTCTACTAAT
ATAATCTGCAATTCTGAGATTCGATTCAATGAGAATGTACACCTTTCCTAACGTCATCACTGATTCATGCATAATGCCGTTCTGGTTGCACAGACATGGATGTATATCGCCTTTCCAGTG
CTGCTGTACACGGGAGAGAGGATCTTCCGGGCTGTCAGATCGTCATTTTATGAGGTGGAGATACTGAAG
GTATGTCAAGTCATTTACCATGCTGCGAAAATGGTTTACCAGACTTGTATA
GATCATATGGAAATCATGTTCAGTCGGGTCTGGAATATCCTGTGGCCAGCCGACTCTCATGGAATATGTTTTCCCGTGAAACAAACGACCCTCATGTGGTATTGTTCTGATCATGTAAAC
AGATAACTGCTGTATTTTCTCATGTAGGCAAATGTGTATCCAGGAAAGGTTTTGTCCCTGACAATTAGCAAGCCCGAAGGCTTTGAGTACAGAAGTGGAATGTATATATACATTCAATGC
TCTCGTATATCACCCTTCGAATG
GTATTCTGCATGCCTTCTTTCTTTTCAAACCGGTCGTTGCCTTGTCCCTTCCAAACTGTGACAGCTATGAGATTATCGCGACGCTCTCCTCGTACTT
TTGCCTGTTTAAAACGACCGTGCTTTCGGTTCTATGTTGATGTCCAGGCACCCGTTTTCATTGACTTCTGGACCAGATGAAGGTCACTTGAGTGTGCACATTAGGACACTTGGAGACTGG
AGTTATCAATTATACAGTCTCTTCCAAGAG
GTAAGGAACAAAAAGGACTCGAATCGATACTCCTCAGAAACCGGGAATCCAAATCTCTGTTGTTTTCTATGCAGGCAACTGTGGCAAGAA
CAGCTAGCTATCCCAAAATGTACATCGACGGGCCTTACGGCGCAGCCTCTCAGGACTATGTCAAGTATGACGTCGTGGTTCTGGTTGGCCTCGGAATAGGAGCAACGCCATTTATCAGCA
TTCTTAAGGATGTCGTCGGTTGCGATCAT
GTAAGTTTCTAGGTTACACCTCCCTTGCATTGTTGCGATCATGTAAGTTTCTAGGTTACACCTCCCTTGCATTGTTGAATAAGATATTCAA
TATGCTTTATTTAACCCTGTGCTGACACAAGGTAAATGCTCGATTTACCAGGTGGATGGCGGAGAAGTTTGCACTCCGAAGGGTCCAGCGAAAGCCTATCTGTACTGGGTTACGAGGGAT
CAGAGCTCCTTTGCCTGGTTCAGGGATTTCATCAAGCAGATATCGAAGACCAACCGGAAAGAGGTTACTGATTGATTCTTACGGCAGCAAGCAAAACCTGAAAATGTCTTCAAGAAAATG
AAGTTGACATGAGTCTTTATAGGCACTGATTTGATATTTGCTTGTACTTTAAAACCAAATTAGTTGTTGTTCCTTTTCAGTCGATTATGGAGATGCACAACTTCCTGACCTCGATGTACA
AGGAGGAGGATGCACGGTCGGTGTTACTAAGCACCATTCAAGCTCTGTCTCGTGCCAAGAGCGGCATCGACTTCATCTCTCAGACCCCG
GTTAGTCGTTCGATCATACTCCACATCTCCA
CATCTGATTTCTGCATGGCAACAGCTTCCAGCTTTTCCATAAAACTTTAAGATCTTCTTGTTCTTGATTGAAAAGATGCGAAGTCGGGCAGTTAGAAGCCCGATCAATGATCATGGTCAT
GAACTTTTTAGCAATCTCAGTTGGCGGTTCGTCTTTACTTGTCATCATACTAAAACCATATGTTCTTTCCGGAGTTGTGTTTGCATGTCTTAAAAGTACAGTCTTCTCATTAACAATGCA
CTCGGCATGCAGTTATGACGTAAATCTTCTTGCCATCCCTGCAAATCGATTAGCACGAATGATTATGACGAAAGCATTCGAATTCAGTTCAACCACTCGTGAATTCATGAGAATACCTCT
CGCTACAAGATCGGTTGATCTAACTTCTAATGTCATTTTCAGGTGCATACTCATTTTGCCAGACCAAATTGGTCCAGCATTTTCTCCAAGTTGTCCCGAAGGCACGGCGGTTCCCAGATT
G
GTGAGACTTCGGCAAACCCCCTGACAACAGTACATCTTTATCATTTGCTTTCGGCATGCTTCTGTGATTCCTCTATTAGAAGGCATTCTACGGCATACAATTCACGGGGTCCTGATCGA
ACTTTAGCGCCATTGGTTGACAAACCATTTGCAAATAATTCACGATGCATCCGTTGTTAAAATCAAATTAGCTAGTGATCTCAAAAGGTGCTTGTGGGACGGATTGCTTTTTCTCCTCGA
TAGGGTTATATCTTGAATCTCCGGCTTATGATTTGCAGGGGTGTTCTATTGTGGTCCTTCAGCATTAGCAGGAGAATTGGAGGAGATGTGCACCAAATTCTCCACCAAGACCATCACAAG
ATTTGTGTTCCATAAGGAGCATTAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCTCCCGAGGCTCATTATACATCCTCCTCCTCCTCCTCATCCTCATCCTCTTCCTTCTCGTCTTCCTACGGCGCCAGCGTGGTTCCGGTCCCGTACTCTCCCGTCCAGACGGAC
CGGGATCACCGTGCCGATGATCACGACGGCGGAATCAACGGCGGCACGGTGGCGGCAACTAGCCTGGCCATCCAGCGGCTGAGGTTCCTGGACGCGAGCGCCAAGCACTGGAGGCAGGTG
GAGGAGCGGTTCGACCGGATCGCCCGGGACCGCTACCGGAATGGCGTCCAGCCGGCGGCCAGGTGGTCGGATTTCGCCTTCTGCGTCG
GAATTCAACGGTCAACGGAATACGCCCAGGAG
CTGCTGCGAGCGCTGCGAGGGAGAGACGGCCTCAAATCCGACATCACAAAGAGCGAACTCCACTACTTCTGGCGCCGCCTCACCGACCCGTGCCCCGACTCCAAAATCCAGATCTTCTTC
GACTT
GTGCGACCGAAATATGGATGGGATAGTTAGCCGGCGCGACGTCAAGCAGGTGATCTTGATGAGTGCTGCCGCGAACAAGGTGAGCTTGACCGGCGAGGAGGCGGACGAGTACACC
GCCCTGATCATGGACGCCGTCGGCTCAGGAGATCGAGGTTACATAGAG
GTCTTGTTCCGGAGCTACTGGCGACGGGCGTGGATCGTGGCCCTCTGGCTGGCGATTTGCGTTGCGCTGTTC
ACGTGGAAGTTCATTCAGTATAGGCATAGGACGGCGTTCGAGGTCATGGGCTACTGCCTTTGCACCGCCAAGGGGGCTGCCGAGACCCTCAAGTTCAACATGGCCGTGATTCTCCTCCCC
GTCTGCCGGAACACAGTCACGTGGCTCCGCGCCAGCCGCCGGGTCAGCTCGATTGTCCCCTTCAACGATAACATCAACTTTCACAAG
TTGATCGCAGCTGGGATCGTGATCGGGGTGATC
CTCCATGGTGGCACCCACTTGGCGTGCGACTTCCCTCGGATCAGTAGCTCGGATCACTCGATCTTCCGCCAGACGATTGCTGCAGGGTTCGGCTACCATCAGCCATCGTATCTCCAGATC
CTGGCCACGACGGAGGTGGCAACAGGGATCGCAATGGTGGTCCTTATGGCAATCGCGTTCTCCCTCGCGACAAGGTGGCCAAGGCGCCAGGCCCCGCCGCTGCCCCGGTCAGTCCGGCAG
GTCACGGGGTACAACACCTTCTGGTACTCACACCACCTCTTCGTCTTCGTGTACGCACTGTTGATCGTGCACTCCATGTTCCTCTTCCTGACCAGCAACCTAATAGAAAAGACG
ACATGG
ATGTATATCGCCTTTCCAGTGCTGCTGTACACGGGAGAGAGGATCTTCCGGGCTGTCAGATCGTCATTTTATGAGGTGGAGATACTGAAG
GCAAATGTGTATCCAGGAAAGGTTTTGTCC
CTGACAATTAGCAAGCCCGAAGGCTTTGAGTACAGAAGTGGAATGTATATATACATTCAATGCTCTCGTATATCACCCTTCGAATG
GCACCCGTTTTCATTGACTTCTGGACCAGATGAA
GGTCACTTGAGTGTGCACATTAGGACACTTGGAGACTGGAGTTATCAATTATACAGTCTCTTCCAAGAG
GCAACTGTGGCAAGAACAGCTAGCTATCCCAAAATGTACATCGACGGGCCT
TACGGCGCAGCCTCTCAGGACTATGTCAAGTATGACGTCGTGGTTCTGGTTGGCCTCGGAATAGGAGCAACGCCATTTATCAGCATTCTTAAGGATGTCGTCGGTTGCGATCAT
TCGATT
ATGGAGATGCACAACTTCCTGACCTCGATGTACAAGGAGGAGGATGCACGGTCGGTGTTACTAAGCACCATTCAAGCTCTGTCTCGTGCCAAGAGCGGCATCGACTTCATCTCTCAGACC
CCG
GTGCATACTCATTTTGCCAGACCAAATTGGTCCAGCATTTTCTCCAAGTTGTCCCGAAGGCACGGCGGTTCCCAGATTGGGGTGTTCTATTGTGGTCCTTCAGCATTAGCAGGAGAA
TTGGAGGAGATGTGCACCAAATTCTCCACCAAGACCATCACAAGATTTGTGTTCCATAAGGAGCATTAC

Retrieve as FASTA