Entry information : TviAPx-CcP01
Entry ID 10612
Creation 2012-02-29 (Marcel Zamocky)
Last sequence changes 2012-02-29 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: TviAPx-CcP01
Name TviAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Trichoderma virens    [TaxId: 29875 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TviAPx-CcP01
start..stop
S start..stop
TharAPx-CcP02 1592 0 1..909 1..931
TaspAPx-CcP01 1588 0 1..909 1..912
TatAPx-CcP01 1571 0 1..909 1..922
HjAPx-CcP01 1538 0 1..909 1..923
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1935721..1937656 1936 N° 2 1934865..1935658 794  
complement(join(1934865..1935658,1935721..1937656))


exon

Literature and cross-references TviAPx-CcP01
Literature Kubicek C.P. et al. (2011) Comparative genome sequence analysis underscores mycoparasitism as the ancestral life style of Trichoderma. Genome Biol. 12:R40-R40
Protein ref. UniProtKB:   G9ME52
DNA ref. JGI genome:   scaffold_1 (1937656..1934865)
Cluster/Prediction ref. JGI gene:   73257
Protein sequence: TviAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   909 (890)
PWM (Da):   %s   95012.08 (93287.1)  
PI (pH):   %s   4.22 (4.20) Peptide Signal:   %s   cut: 20 range:20-909
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKSTAALVGLLGLAGSALADPTWPNAIDEIEEIMTQLQSFRARKFADTVSPCSNEASGPGRQNAAEWLRVGFHDMSTANTHFGIGGLDASLQYELDDGENTGPGHKTTLEFMAPYVSPRSSLADLIALGVYTSVRSCGGPAVPIRVGRIDATGKGPTGVPQPQNSVFTFQQQFERMGFNVAEMIQVTACGHTLGGVHNTEFPDIVPTGTGLNGEAGLDSTDAAFDNKVVTEYLSGETANPLVVGPSVKIDKNSDFKVFNSDGNATMEALADADTFASTCKTVLQKMIEVVPPGVTFSDPIVPYKVKPVGLQLTLINGGTTLQLTGFIRVKTTGLPDNSISSVSITYKNRKGTTDCGLSSCVVTSQVQGTSHGFDDTFNFYPISTNILATSGISSFTVTVNNADGTKDIYDNNGKEYPVQDAIVFQAPQSCVLGSSGALTAVAAVRNDRLSQGAQAKIWFKTPQTTSPVPLLQSTTVDLQKGQCVGSYTLFNIDYTIQGGLAYQGYVDVINGDQSDSFKALTSIGGTCRAFASPAACNGGDEGSGGTTGIPTVPSTTNAVPTTDPATSEPVTTQPPTTTVPPTTTAIPTPTHKPSVDGYVLVSCWTEGDGVRALSGSAYANDSMTLETCRDFCSSYVYWGTEYGRECYCGNTLAKSSEAAPIDQCNMVCGGNGAEFCGAGNRLELYSTTVTQPPSPTGTLIHEPTVGAYTLVGCWTEGQGDRALGQAATQAADMTNEACAAFCSNYRYFGTEYGDECYCGSFLSTSSATAPLADCNMPCGGDQFEYCGASNRLELYINPNITGGEPEQPAAAGDFVFIGCQTEGNNTRALTGAATATGTMSNEACATFCDGFAYFGTEYGSECYCGDTLAPSSLKAPASDCNMLCSGNDLEFCGAGNRLSLYNKKPAELT

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). Peroxidase domain fused to 3 WSC domains (putative carbohydrate binding domain)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTCAACAGCTGCCTTGGTGGGCCTCCTCGGCCTGGCTGGCTCAGCCCTGGCTGACCCTACATGGCCCAACGCAATCGACGAGATTGAGGAGATCATGACCCAGCTTCAGTCGTTC
CGCGCCCGCAAATTCGCCGATACCGTGAGCCCATGCTCCAACGAAGCCTCGGGCCCTGGCCGGCAGAACGCCGCTGAGTGGCTCCGAGTCGGCTTCCACGACATGTCCACGGCCAACACC
CATTTCGGCATTGGTGGTCTGGATGCCTCGCTCCAGTACGAGCTGGACGACGGTGAAAACACCGGGCCTGGCCACAAGACGACCCTCGAGTTCATGGCCCCCTATGTCTCTCCCCGGTCA
AGCTTGGCTGATCTCATCGCCCTGGGCGTCTACACATCTGTTCGCTCTTGCGGCGGCCCTGCAGTGCCCATCCGTGTCGGCCGTATCGATGCCACCGGCAAGGGACCTACGGGCGTTCCC
CAGCCCCAAAACTCGGTTTTCACCTTCCAGCAGCAGTTTGAGCGCATGGGTTTCAATGTTGCAGAAATGATCCAAGTCACCGCCTGTGGTCACACTCTTGGCGGCGTCCACAACACCGAG
TTCCCTGATATTGTTCCCACAGGAACTGGACTCAACGGCGAGGCGGGTCTCGACAGCACCGATGCCGCCTTCGACAACAAGGTCGTAACCGAGTATCTCTCCGGAGAGACCGCGAATCCC
CTTGTTGTCGGTCCATCTGTCAAGATTGACAAGAACTCCGATTTCAAGGTCTTCAATTCCGATGGCAACGCAACCATGGAGGCTTTGGCCGATGCCGATACTTTTGCCTCCACTTGCAAG
ACTGTCCTGCAAAAGATGATTGAGGTCGTCCCTCCAGGCGTCACCTTCTCCGACCCCATTGTCCCTTACAAGGTCAAGCCTGTAGGCTTGCAGCTGACTCTTATCAACGGCGGCACCACC
CTCCAGCTCACTGGCTTTATCCGCGTCAAGACCACCGGGCTCCCCGATAACAGCATATCTAGCGTGTCCATCACTTACAAGAACCGCAAGGGTACCACTGATTGCGGCCTCAGCTCTTGC
GTTGTCACCAGCCAGGTCCAGGGCACCAGCCATGGCTTTGATGATACCTTTAACTTCTACCCCATCTCGACCAACATCCTTGCTACTTCGGGTATCTCGTCCTTCACCGTCACTGTCAAC
AACGCCGACGGCACCAAGGACATCTACGACAACAACGGGAAAGAGTATCCTGTCCAGGATGCCATTGTCTTCCAGGCTCCCCAGAGCTGTGTACTCGGATCCTCGGGTGCTCTGACTGCC
GTGGCTGCCGTCCGCAACGACCGCCTCAGCCAGGGTGCGCAGGCTAAAATCTGGTTCAAGACTCCCCAGACAACCAGCCCCGTTCCTCTCCTGCAGAGTACCACCGTCGACCTCCAGAAG
GGCCAGTGTGTCGGATCGTACACTCTGTTCAATATTGACTACACCATCCAGGGTGGTCTGGCTTACCAGGGATACGTTGATGTTATCAACGGCGACCAGTCTGATAGCTTCAAGGCCCTC
ACCAGCATCGGCGGTACTTGCCGTGCATTTGCCAGCCCGGCTGCCTGCAACGGTGGAGATGAGGGATCCGGTGGCACAACGGGCATCCCAACTGTCCCATCCACTACCAATGCCGTCCCT
ACAACCGACCCTGCTACCAGCGAGCCTGTCACTACTCAGCCACCCACAACGACAGTGCCTCCCACGACTACTGCAATTCCCACCCCCACCCACAAACCATCAGTTGACGGTTATGTCCTT
GTTTCTTGCTGGACCGAGGGCGATGGTGTGCGTGCACTTTCCGGCAGCGCCTACGCCAATGACTCGATGACTTTGGAAACCTGCAGAGACTTTTGCAGCAGCTACGTCTACTGGGGTACC
GAATATGGCCGCGAAT
GTGAGCATAACACCCTTACACGTCTTTTGAATTCTAGTTGTACTAACCAATGTGTGACTCAGGTTATTGTGGTAACACACTTGCCAAGAGCAGCGAGGCAGCTC
CCATTGATCAATGCAACATGGTCTGTGGTGGTAACGGTGCTGAATTCTGTGGTGCTGGCAACCGTCTTGAGCTGTACTCAACCACAGTCACCCAGCCTCCCTCTCCTACCGGCACCCTGA
TTCACGAGCCTACTGTTGGTGCATACACCTTGGTGGGCTGCTGGACGGAGGGCCAAGGCGATCGCGCTCTAGGCCAGGCGGCTACGCAGGCAGCTGACATGACCAACGAGGCTTGTGCCG
CGTTCTGTTCCAACTACAGGTACTTTGGTACTGAGTATGGCGATGAGTGCTACTGCGGTAGCTTCCTTTCCACCAGCAGCGCAACTGCTCCTCTTGCCGACTGCAATATGCCCTGCGGTG
GTGACCAGTTTGAGTACTGCGGAGCCAGCAACCGCCTTGAACTTTACATCAACCCCAACATTACTGGTGGAGAGCCTGAGCAGCCTGCTGCTGCTGGCGACTTTGTGTTTATCGGCTGCC
AGACAGAGGGCAACAACACCCGTGCCCTGACAGGCGCTGCTACTGCAACAGGTACCATGTCGAATGAGGCCTGTGCCACCTTCTGTGACGGCTTCGCATACTTTGGTACTGAGTACGGCA
GCGAATGCTACTGTGGCGACACTCTGGCGCCGTCATCTCTGAAGGCTCCGGCGTCTGACTGCAACATGCTTTGCAGCGGCAACGATCTTGAGTTCTGTGGTGCCGGCAACCGCCTGTCAC
TGTATAACAAGAAGCCTGCTGAGCTCACTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTCAACAGCTGCCTTGGTGGGCCTCCTCGGCCTGGCTGGCTCAGCCCTGGCTGACCCTACATGGCCCAACGCAATCGACGAGATTGAGGAGATCATGACCCAGCTTCAGTCGTTC
CGCGCCCGCAAATTCGCCGATACCGTGAGCCCATGCTCCAACGAAGCCTCGGGCCCTGGCCGGCAGAACGCCGCTGAGTGGCTCCGAGTCGGCTTCCACGACATGTCCACGGCCAACACC
CATTTCGGCATTGGTGGTCTGGATGCCTCGCTCCAGTACGAGCTGGACGACGGTGAAAACACCGGGCCTGGCCACAAGACGACCCTCGAGTTCATGGCCCCCTATGTCTCTCCCCGGTCA
AGCTTGGCTGATCTCATCGCCCTGGGCGTCTACACATCTGTTCGCTCTTGCGGCGGCCCTGCAGTGCCCATCCGTGTCGGCCGTATCGATGCCACCGGCAAGGGACCTACGGGCGTTCCC
CAGCCCCAAAACTCGGTTTTCACCTTCCAGCAGCAGTTTGAGCGCATGGGTTTCAATGTTGCAGAAATGATCCAAGTCACCGCCTGTGGTCACACTCTTGGCGGCGTCCACAACACCGAG
TTCCCTGATATTGTTCCCACAGGAACTGGACTCAACGGCGAGGCGGGTCTCGACAGCACCGATGCCGCCTTCGACAACAAGGTCGTAACCGAGTATCTCTCCGGAGAGACCGCGAATCCC
CTTGTTGTCGGTCCATCTGTCAAGATTGACAAGAACTCCGATTTCAAGGTCTTCAATTCCGATGGCAACGCAACCATGGAGGCTTTGGCCGATGCCGATACTTTTGCCTCCACTTGCAAG
ACTGTCCTGCAAAAGATGATTGAGGTCGTCCCTCCAGGCGTCACCTTCTCCGACCCCATTGTCCCTTACAAGGTCAAGCCTGTAGGCTTGCAGCTGACTCTTATCAACGGCGGCACCACC
CTCCAGCTCACTGGCTTTATCCGCGTCAAGACCACCGGGCTCCCCGATAACAGCATATCTAGCGTGTCCATCACTTACAAGAACCGCAAGGGTACCACTGATTGCGGCCTCAGCTCTTGC
GTTGTCACCAGCCAGGTCCAGGGCACCAGCCATGGCTTTGATGATACCTTTAACTTCTACCCCATCTCGACCAACATCCTTGCTACTTCGGGTATCTCGTCCTTCACCGTCACTGTCAAC
AACGCCGACGGCACCAAGGACATCTACGACAACAACGGGAAAGAGTATCCTGTCCAGGATGCCATTGTCTTCCAGGCTCCCCAGAGCTGTGTACTCGGATCCTCGGGTGCTCTGACTGCC
GTGGCTGCCGTCCGCAACGACCGCCTCAGCCAGGGTGCGCAGGCTAAAATCTGGTTCAAGACTCCCCAGACAACCAGCCCCGTTCCTCTCCTGCAGAGTACCACCGTCGACCTCCAGAAG
GGCCAGTGTGTCGGATCGTACACTCTGTTCAATATTGACTACACCATCCAGGGTGGTCTGGCTTACCAGGGATACGTTGATGTTATCAACGGCGACCAGTCTGATAGCTTCAAGGCCCTC
ACCAGCATCGGCGGTACTTGCCGTGCATTTGCCAGCCCGGCTGCCTGCAACGGTGGAGATGAGGGATCCGGTGGCACAACGGGCATCCCAACTGTCCCATCCACTACCAATGCCGTCCCT
ACAACCGACCCTGCTACCAGCGAGCCTGTCACTACTCAGCCACCCACAACGACAGTGCCTCCCACGACTACTGCAATTCCCACCCCCACCCACAAACCATCAGTTGACGGTTATGTCCTT
GTTTCTTGCTGGACCGAGGGCGATGGTGTGCGTGCACTTTCCGGCAGCGCCTACGCCAATGACTCGATGACTTTGGAAACCTGCAGAGACTTTTGCAGCAGCTACGTCTACTGGGGTACC
GAATATGGCCGCGAAT
GTTATTGTGGTAACACACTTGCCAAGAGCAGCGAGGCAGCTCCCATTGATCAATGCAACATGGTCTGTGGTGGTAACGGTGCTGAATTCTGTGGTGCTGGCAAC
CGTCTTGAGCTGTACTCAACCACAGTCACCCAGCCTCCCTCTCCTACCGGCACCCTGATTCACGAGCCTACTGTTGGTGCATACACCTTGGTGGGCTGCTGGACGGAGGGCCAAGGCGAT
CGCGCTCTAGGCCAGGCGGCTACGCAGGCAGCTGACATGACCAACGAGGCTTGTGCCGCGTTCTGTTCCAACTACAGGTACTTTGGTACTGAGTATGGCGATGAGTGCTACTGCGGTAGC
TTCCTTTCCACCAGCAGCGCAACTGCTCCTCTTGCCGACTGCAATATGCCCTGCGGTGGTGACCAGTTTGAGTACTGCGGAGCCAGCAACCGCCTTGAACTTTACATCAACCCCAACATT
ACTGGTGGAGAGCCTGAGCAGCCTGCTGCTGCTGGCGACTTTGTGTTTATCGGCTGCCAGACAGAGGGCAACAACACCCGTGCCCTGACAGGCGCTGCTACTGCAACAGGTACCATGTCG
AATGAGGCCTGTGCCACCTTCTGTGACGGCTTCGCATACTTTGGTACTGAGTACGGCAGCGAATGCTACTGTGGCGACACTCTGGCGCCGTCATCTCTGAAGGCTCCGGCGTCTGACTGC
AACATGCTTTGCAGCGGCAACGATCTTGAGTTCTGTGGTGCCGGCAACCGCCTGTCACTGTATAACAAGAAGCCTGCTGAGCTCACTTAG

Retrieve as FASTA