Entry information : TatAPx-CcP01
Entry ID 10613
Creation 2012-02-29 (Marcel Zamocky)
Last sequence changes 2012-02-29 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: TatAPx-CcP01
Name TatAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Trichoderma
Organism Trichoderma atroviride    [TaxId: 63577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TatAPx-CcP01
start..stop
S start..stop
TaspAPx-CcP01 1714 0 1..922 1..912
TviAPx-CcP01 1587 0 1..922 1..909
TharAPx-CcP02 1522 0 1..922 1..931
HjAPx-CcP01 1513 0 1..922 1..923
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 430140..432114 1975 N° 2 432184..432977 794  
join(430140..432114,432184..432977)


exon

Literature and cross-references TatAPx-CcP01
Literature Kubicek C.P. et al. (2011)Comparative genome sequence analysis underscores mycoparasitism as the ancestral life style of Trichoderma.
Genome Biol. 12 (4), R40 (2011)
Protein ref. UniProtKB:   G9NFC0
DNA ref. JGI genome:   contig_13 (430140..432977)
Protein sequence: TatAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   922 (903)
PWM (Da):   %s   96637.79 (94855.8)  
PI (pH):   %s   4.18 (4.14) Peptide Signal:   %s   cut: 20 range:20-922
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKSTAALLGLLGLAGSARADPTWPNAIDEIEEIMTQLQSFRARKFADTVSPCSNEASGPGRQNAAEWLRVGFHDMSTANTFFGIGGLDASLQYELNDGENTGPGHKTTLEFMGPYLSPRSSLADLIALGVYTSVRSCGGPSVPIRVGRIDATQAGPVGVPQPQNSVFTFQQQFQRMGFNTEEMIQVTACGHTLGGVHNTEFPTLVPTGTGADGEGSLDSTDAVFDNKVVTEYLSGNTTNPLVVGPSVKLGMNSDFKVFNADGNQTMEALADADSFTSVCKTVLQKMIEVVPPGVKLSDPIVPYKIKPVNMQLTLINGGSTLQLTGYIRVKTTGLAQNSISSVTITYKNRKGTTDCGLSSCVVTATVQGISQGFDDTFNFYPIAANILATSGISSFTITVNNADGTKDVYDNNGQEYPIQDAIVFQAPQSCVLGSSGALTAVAAVRNDRLSQGAQARIWYKTPQTSSPIPLLQNTTLDLQKGQCVGPYTLFNVDYAIQGGLAYEGYVDVISGDQSDSFKALTGIGGTCRAFANPATCNGGDSGSVGSTSISTLPATTSAAPTSEPATSDPITSDPPTTVPPATVPPTTVPPTTVPPTTTVAAPTHRPTVGGYVMVSCWTEGDAVRALNGNSYSNDSMTLESCKDYCSSYVYWGTEYGRECYCGNTLAKSSEAAPIGECNMVCAGDGSEFCGAGNRLELYSTTVTQPPSPTGTLTHEPTVGPYTLVGCWTEGEGVRALAQDATIAENMTNEACSEFCSDYRYFGTEYGDECYCGSFLESTSATAPLADCNMPCAGNQFEYCGASNRLELYINPNVTGGSPEQPAAAGDFVFVGCQTEGNGTRALTGSASAAGTMSNEACATFCDEFKYFGTEYGSECYCGNALDPSSLEAPASNCNMLCSGNDLEYCGAGNRLSLYTKKPAQIT

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). Peroxidase domain fused to 3 WSC domains (putative carbohydrate binding domain)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTCGACTGCTGCCCTATTGGGCCTCCTCGGCCTGGCTGGCTCAGCTCGTGCTGATCCCACATGGCCAAACGCAATAGACGAGATTGAGGAGATCATGACCCAGCTTCAGTCGTTC
CGCGCACGCAAATTTGCCGACACTGTGAGCCCATGCTCCAATGAGGCCTCGGGCCCCGGCCGACAGAACGCTGCCGAGTGGCTCCGTGTCGGCTTCCACGACATGTCCACGGCGAACACC
TTCTTTGGCATTGGTGGCCTCGACGCCTCGCTCCAGTACGAGCTGAACGATGGTGAAAACACCGGTCCGGGCCACAAGACGACGCTGGAGTTTATGGGCCCTTACCTCTCTCCTCGATCT
TCTTTGGCAGATTTGATTGCCTTGGGCGTCTATACATCCGTTCGCTCTTGTGGCGGCCCTTCTGTCCCAATTCGCGTTGGCCGAATAGATGCCACCCAGGCGGGACCTGTGGGCGTGCCC
CAGCCCCAAAACTCAGTCTTTACCTTTCAGCAGCAGTTTCAACGCATGGGCTTTAATACCGAGGAAATGATCCAGGTCACTGCCTGTGGTCACACTCTGGGTGGTGTTCACAACACCGAA
TTTCCCACTCTTGTTCCCACCGGGACCGGTGCCGACGGCGAAGGGAGCCTTGACTCGACTGATGCCGTTTTCGACAACAAGGTCGTAACTGAGTATCTGTCTGGGAATACCACAAACCCT
CTTGTTGTCGGTCCCTCGGTCAAGCTTGGCATGAACTCCGACTTCAAGGTATTCAATGCCGATGGTAACCAGACCATGGAGGCTTTGGCCGATGCCGACAGCTTCACCTCTGTCTGCAAG
ACTGTGCTGCAAAAGATGATTGAAGTTGTTCCTCCTGGTGTCAAGCTGTCCGACCCCATCGTGCCTTACAAGATCAAGCCTGTAAACATGCAGCTGACACTCATCAATGGCGGCAGCACC
CTTCAGCTCACGGGTTACATCCGCGTCAAAACCACTGGCCTTGCACAGAACAGCATATCCAGCGTAACCATCACCTATAAGAACCGCAAGGGCACCACCGACTGTGGCCTCAGCTCTTGT
GTTGTCACCGCCACCGTTCAGGGCATTAGCCAAGGTTTCGACGATACTTTCAACTTCTATCCCATTGCGGCCAACATCCTCGCCACGTCTGGTATCTCGTCCTTTACCATTACTGTTAAC
AACGCCGATGGCACCAAGGATGTTTACGACAACAACGGCCAAGAGTATCCCATCCAAGATGCAATCGTCTTCCAGGCTCCCCAGAGCTGCGTCCTGGGATCCTCTGGTGCTCTGACTGCT
GTGGCTGCCGTTCGCAACGACCGTCTCAGCCAAGGTGCGCAGGCCAGAATCTGGTACAAGACTCCCCAGACAAGTAGCCCTATTCCCCTCCTGCAAAATACCACGCTTGACCTCCAAAAA
GGTCAATGTGTCGGGCCTTATACTTTATTCAATGTCGACTACGCCATACAGGGTGGCCTAGCCTACGAGGGATACGTCGATGTCATCAGCGGCGACCAGTCTGATAGCTTCAAGGCCCTT
ACAGGCATCGGTGGTACTTGCCGTGCTTTTGCCAATCCTGCCACATGCAATGGCGGCGATTCAGGATCTGTTGGCTCGACGAGCATCTCAACTCTTCCAGCCACCACTTCTGCTGCCCCT
ACATCTGAGCCTGCAACCAGCGACCCGATTACCTCTGACCCCCCTACGACGGTACCTCCTGCGACAGTACCTCCTACAACAGTGCCTCCAACAACAGTGCCTCCCACTACGACAGTTGCT
GCTCCCACTCACCGTCCTACGGTTGGGGGGTATGTAATGGTATCTTGCTGGACGGAGGGTGATGCCGTGCGTGCACTAAACGGCAACTCATACTCCAACGACTCGATGACTTTGGAAAGC
TGCAAGGACTACTGCAGTAGCTACGTCTACTGGGGAACTGAATACGGTCGAGAAT
GTGAGTGTCTCTTATCTGGCTTTTATATACGTCTTATTGAACTTTGTAACTAACTCATGCGCGAC
TCAGGTTATTGTGGTAACACGCTGGCCAAGAGCAGTGAGGCAGCCCCTATTGGTGAGTGCAACATGGTTTGCGCTGGCGATGGCAGTGAGTTCTGCGGTGCCGGCAACCGTCTTGAGCTT
TATTCAACAACTGTCACTCAGCCTCCCTCTCCCACTGGCACTCTAACTCACGAGCCCACTGTCGGTCCATATACACTGGTGGGGTGCTGGACGGAAGGTGAGGGCGTTCGTGCTCTGGCC
CAGGATGCCACTATTGCAGAGAACATGACGAACGAAGCCTGTTCTGAATTCTGTTCAGATTATAGGTACTTTGGCACTGAGTACGGTGATGAGTGCTATTGCGGTAGCTTCCTCGAGAGC
ACCAGCGCAACTGCACCTCTGGCCGATTGTAACATGCCCTGCGCTGGCAATCAGTTCGAGTACTGCGGAGCCAGCAACCGTCTTGAGCTTTATATCAACCCCAACGTTACTGGCGGCTCG
CCCGAGCAGCCCGCTGCTGCTGGTGACTTTGTATTCGTCGGCTGCCAAACAGAAGGCAACGGCACCCGTGCCCTGACTGGTTCTGCCAGCGCTGCAGGTACCATGTCGAATGAAGCTTGT
GCCACGTTTTGCGATGAGTTTAAGTACTTTGGCACTGAGTATGGCAGCGAATGCTACTGCGGCAACGCTCTTGATCCGTCTTCTTTGGAGGCTCCCGCGTCCAACTGCAACATGCTCTGC
AGCGGCAACGACCTAGAGTACTGTGGCGCGGGTAACCGCCTGTCACTTTACACGAAGAAACCCGCTCAAATTACATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTCGACTGCTGCCCTATTGGGCCTCCTCGGCCTGGCTGGCTCAGCTCGTGCTGATCCCACATGGCCAAACGCAATAGACGAGATTGAGGAGATCATGACCCAGCTTCAGTCGTTC
CGCGCACGCAAATTTGCCGACACTGTGAGCCCATGCTCCAATGAGGCCTCGGGCCCCGGCCGACAGAACGCTGCCGAGTGGCTCCGTGTCGGCTTCCACGACATGTCCACGGCGAACACC
TTCTTTGGCATTGGTGGCCTCGACGCCTCGCTCCAGTACGAGCTGAACGATGGTGAAAACACCGGTCCGGGCCACAAGACGACGCTGGAGTTTATGGGCCCTTACCTCTCTCCTCGATCT
TCTTTGGCAGATTTGATTGCCTTGGGCGTCTATACATCCGTTCGCTCTTGTGGCGGCCCTTCTGTCCCAATTCGCGTTGGCCGAATAGATGCCACCCAGGCGGGACCTGTGGGCGTGCCC
CAGCCCCAAAACTCAGTCTTTACCTTTCAGCAGCAGTTTCAACGCATGGGCTTTAATACCGAGGAAATGATCCAGGTCACTGCCTGTGGTCACACTCTGGGTGGTGTTCACAACACCGAA
TTTCCCACTCTTGTTCCCACCGGGACCGGTGCCGACGGCGAAGGGAGCCTTGACTCGACTGATGCCGTTTTCGACAACAAGGTCGTAACTGAGTATCTGTCTGGGAATACCACAAACCCT
CTTGTTGTCGGTCCCTCGGTCAAGCTTGGCATGAACTCCGACTTCAAGGTATTCAATGCCGATGGTAACCAGACCATGGAGGCTTTGGCCGATGCCGACAGCTTCACCTCTGTCTGCAAG
ACTGTGCTGCAAAAGATGATTGAAGTTGTTCCTCCTGGTGTCAAGCTGTCCGACCCCATCGTGCCTTACAAGATCAAGCCTGTAAACATGCAGCTGACACTCATCAATGGCGGCAGCACC
CTTCAGCTCACGGGTTACATCCGCGTCAAAACCACTGGCCTTGCACAGAACAGCATATCCAGCGTAACCATCACCTATAAGAACCGCAAGGGCACCACCGACTGTGGCCTCAGCTCTTGT
GTTGTCACCGCCACCGTTCAGGGCATTAGCCAAGGTTTCGACGATACTTTCAACTTCTATCCCATTGCGGCCAACATCCTCGCCACGTCTGGTATCTCGTCCTTTACCATTACTGTTAAC
AACGCCGATGGCACCAAGGATGTTTACGACAACAACGGCCAAGAGTATCCCATCCAAGATGCAATCGTCTTCCAGGCTCCCCAGAGCTGCGTCCTGGGATCCTCTGGTGCTCTGACTGCT
GTGGCTGCCGTTCGCAACGACCGTCTCAGCCAAGGTGCGCAGGCCAGAATCTGGTACAAGACTCCCCAGACAAGTAGCCCTATTCCCCTCCTGCAAAATACCACGCTTGACCTCCAAAAA
GGTCAATGTGTCGGGCCTTATACTTTATTCAATGTCGACTACGCCATACAGGGTGGCCTAGCCTACGAGGGATACGTCGATGTCATCAGCGGCGACCAGTCTGATAGCTTCAAGGCCCTT
ACAGGCATCGGTGGTACTTGCCGTGCTTTTGCCAATCCTGCCACATGCAATGGCGGCGATTCAGGATCTGTTGGCTCGACGAGCATCTCAACTCTTCCAGCCACCACTTCTGCTGCCCCT
ACATCTGAGCCTGCAACCAGCGACCCGATTACCTCTGACCCCCCTACGACGGTACCTCCTGCGACAGTACCTCCTACAACAGTGCCTCCAACAACAGTGCCTCCCACTACGACAGTTGCT
GCTCCCACTCACCGTCCTACGGTTGGGGGGTATGTAATGGTATCTTGCTGGACGGAGGGTGATGCCGTGCGTGCACTAAACGGCAACTCATACTCCAACGACTCGATGACTTTGGAAAGC
TGCAAGGACTACTGCAGTAGCTACGTCTACTGGGGAACTGAATACGGTCGAGAAT
GTTATTGTGGTAACACGCTGGCCAAGAGCAGTGAGGCAGCCCCTATTGGTGAGTGCAACATGGTT
TGCGCTGGCGATGGCAGTGAGTTCTGCGGTGCCGGCAACCGTCTTGAGCTTTATTCAACAACTGTCACTCAGCCTCCCTCTCCCACTGGCACTCTAACTCACGAGCCCACTGTCGGTCCA
TATACACTGGTGGGGTGCTGGACGGAAGGTGAGGGCGTTCGTGCTCTGGCCCAGGATGCCACTATTGCAGAGAACATGACGAACGAAGCCTGTTCTGAATTCTGTTCAGATTATAGGTAC
TTTGGCACTGAGTACGGTGATGAGTGCTATTGCGGTAGCTTCCTCGAGAGCACCAGCGCAACTGCACCTCTGGCCGATTGTAACATGCCCTGCGCTGGCAATCAGTTCGAGTACTGCGGA
GCCAGCAACCGTCTTGAGCTTTATATCAACCCCAACGTTACTGGCGGCTCGCCCGAGCAGCCCGCTGCTGCTGGTGACTTTGTATTCGTCGGCTGCCAAACAGAAGGCAACGGCACCCGT
GCCCTGACTGGTTCTGCCAGCGCTGCAGGTACCATGTCGAATGAAGCTTGTGCCACGTTTTGCGATGAGTTTAAGTACTTTGGCACTGAGTATGGCAGCGAATGCTACTGCGGCAACGCT
CTTGATCCGTCTTCTTTGGAGGCTCCCGCGTCCAACTGCAACATGCTCTGCAGCGGCAACGACCTAGAGTACTGTGGCGCGGGTAACCGCCTGTCACTTTACACGAAGAAACCCGCTCAA
ATTACATAG

Retrieve as FASTA