Entry information : Ecam1CysPrx03-2 (EcC054495.30)
Entry ID 10615
Creation 2012-02-29 (Qiang Li)
Last sequence changes 2013-03-13 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-03-13 (Qiang Li)
Peroxidase information: Ecam1CysPrx03-2 (EcC054495.30)
Name (synonym) Ecam1CysPrx03-2 (EcC054495.30)
Class 1-Cysteine peroxiredoxin    [Orthogroup: 1CysPrx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value Ecam1CysPrx03-2
start..stop
S start..stop
Egu1CysPrx03 453 2e-165 1..220 1..220
Egr1CysPrx03 453 2e-165 1..220 1..220
Ecam1CysPrx03-1 447 7e-163 1..217 1..217
Egl1CysPrx03-1 409 3e-148 19..216 1..198
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..118 118 N° 2 217..365 149 N° 3 722..868 147 N° 4 998..1243 246
join(1..118,217..365,722..868,998..1243)


exon

Literature and cross-references Ecam1CysPrx03-2 (EcC054495.30)
Protein sequence: Ecam1CysPrx03-2 (EcC054495.30)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   220
PWM (Da):   %s   24309.57  
PI (pH):   %s   8.08
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPGLTLGDTVPDLAVETTHGKMKLHDYIGGAWTILFSHPGDFTPVCTTELGKMAAYAPEFERRGVKLLGLSCDEVESHKAWIKDIEAFPGAKVTYPIIADPNREIIKQLNMVEPEEKDASGKQVPSRALHIVGPDKKIKLSFLYPASTGRNMDEVVRVLESLQRATKYKIATPCNWKPGEAVVISPSISNEQVKEMFPQGYKTANLPSKKDYLRFTHVD

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCAGGCCTGACGCTCGGCGACACCGTCCCGGACCTCGCCGTCGAGACCACCCACGGCAAGATGAAGCTCCACGACTACATCGGCGGCGCCTGGACCATCCTCTTCTCTCACCCCGGT
AACCGTCGTCGTCNNNNNNNNNNNNNNNNNNNNCCGCATGTTTCGACGGCCCCGAGAAAAGGGAAGCCTTGTTCACCCACGACATCGCTTGCGCAGGGGATTTCACGCCGGTGTGCACGA
CGGAGCTCGGGAAGATGGCGGCGTACGCACCGGAGTTCGAGCGGCGAGGGGTGAAGCTCCTGGGCTTGTCCTGCGACGAGGTCGAGTCGCACAAGGCGTGGATCAAGGACATAGAGGCCT
TCACC
GTCAGCTACTCTTCTCCCTATTAAACCTTTTTTTTATCACTTGGCACATATGTATATGTCTTGTAGGAACTTGCTTTTTGGGATTTCGATGTTGTGTTTTATCTGGTTATGGTGA
TAGTATCCTTCAGAAAGAAAAAGAAAGAGAACTTATAGGAATGTGTAGTATTATGATTTAGTAGAGTGACCAAGGGAAGTCTCCTTAATCTTAGGCACAATTTGGGTAGAATGAGGTGGT
TTAATTGTGCGTCACAAGGCTGACTCACATTTGAGATTGGGACCTTTGGCTTTTGTGCAATTTTCATTATTCCAATTTCGAGACAACATCCTCAATATCGTGTTATTTGGTGGGGGTGTA
GCCTGGTGCTAAGGTGACGTACCCGATAATTGCCGACCCGAATAGAGAGATAATCAAACAGCTCAACATGGTCGAGCCTGAGGAGAAAGACGCCTCCGGGAAGCAAGTCCCTTCTAGAGC
TCTGCACATCGTCGGTCCTGATAAGAAG
GTATACGTGCTCCTCTTAACTTTTCTATTCCGTGTTAATTAAACTTTTATCGGATGAAACAAATTGCATAAACCAATGTCATCTCATGCATG
TCGTTTTCGGTTTCACGATATAACATAAATTGTATAGATCAAGCTGAGTTTTCTGTACCCGGCGAGCACGGGGAGGAACATGGACGAGGTGGTGAGGGTGCTGGAATCGCTGCAGAGGGC
GACGAAGTACAAGATCGCCACCCCGTGCAACTGGAAGCCGGGGGAGGCGGTTGTCATCTCACCGTCCATCTCCAACGAGCAGGTCAAGGAGATGTTCCCGCAGGGCTACAAGACCGCCAA
TCTCCCGTCCAAGAAGGATTACCTCCGCTTCACTCATGTTGAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCAGGCCTGACGCTCGGCGACACCGTCCCGGACCTCGCCGTCGAGACCACCCACGGCAAGATGAAGCTCCACGACTACATCGGCGGCGCCTGGACCATCCTCTTCTCTCACCCCGGG
GATTTCACGCCGGTGTGCACGACGGAGCTCGGGAAGATGGCGGCGTACGCACCGGAGTTCGAGCGGCGAGGGGTGAAGCTCCTGGGCTTGTCCTGCGACGAGGTCGAGTCGCACAAGGCG
TGGATCAAGGACATAGAGGCCTTCACC
CCTGGTGCTAAGGTGACGTACCCGATAATTGCCGACCCGAATAGAGAGATAATCAAACAGCTCAACATGGTCGAGCCTGAGGAGAAAGACGCC
TCCGGGAAGCAAGTCCCTTCTAGAGCTCTGCACATCGTCGGTCCTGATAAGAAG
ATCAAGCTGAGTTTTCTGTACCCGGCGAGCACGGGGAGGAACATGGACGAGGTGGTGAGGGTGCTG
GAATCGCTGCAGAGGGCGACGAAGTACAAGATCGCCACCCCGTGCAACTGGAAGCCGGGGGAGGCGGTTGTCATCTCACCGTCCATCTCCAACGAGCAGGTCAAGGAGATGTTCCCGCAG
GGCTACAAGACCGCCAATCTCCCGTCCAAGAAGGATTACCTCCGCTTCACTCATGTTGAT

Retrieve as FASTA