Entry information : EcamRboh01 (EcS536697.10)
Entry ID 10618
Creation 2012-02-29 (Qiang Li)
Last sequence changes 2012-02-29 (Qiang Li)
Sequence status partial
Reviewer Li
Last annotation changes 2013-05-23 (Li)
Peroxidase information: EcamRboh01 (EcS536697.10)
Name (synonym) EcamRboh01 (EcS536697.10)
Class Respiratory burst oxidase homolog     [Orthogroup: Rboh001]*
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamRboh01
start..stop
S start..stop
EgrRboh01 1640 0 1..789 137..925
EguRboh01 1622 0 1..789 137..925
EglRboh01 1622 0 1..789 68..856
VvRboh07 1341 0 1..789 125..917
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..196 196 N° 2 323..479 157 N° 3 1202..1250 49 N° 4 1467..1580 114
N° 5 1708..2130 423 N° 6 2523..2906 384 N° 7 3011..3106 96 N° 8 3288..3403 116
N° 9 3488..3658 171 N° 10 3746..3902 157 N° 11 3986..4174 189 N° 12 4282..4410 129
N° 13 4602..4680 79 N° 14 5164..5273 110  
join(1..196,323..479,1202..1250,1467..1580,1708..2130,2523..2906,3011..3106,3288 ..3403,3488..3658,3746..3902,3986..4174,4282..4410,4602..4680,5164..5273)


exon

Literature and cross-references EcamRboh01 (EcS536697.10)
Protein sequence: EcamRboh01 (EcS536697.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   789
PWM (Da):   %s   90056.27 Transmb domain:   %s   o228-250i309-328o364-386i409-431o441-455i591-608o
PI (pH):   %s   9.44
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
EARRARAQLDRSRSSAQRALKGLRFISKANFCARDAEELWRQVEARFHRLARDGLLAREDFGECIGMDSKEFAVGMFDALARRRRQRIGKITREELHDFWLQISDQSFDARLQIFFDMADSNEDGRITRAEVQLLMLSASANKLSKLKERAEEYASLIMEELDPENLGYIELWQLETLLLQKDTYMNYSRTLSTTSVGWSQNLSSFRPTDKVRRICSSLRCLVLENWQRGWILLLWAIVMGCLFAWKFIQYRNMAAFHVMGYCLATAKGAAETLKLNMALILLPVCRNTLTWLRSTRARSLIPFDDNINFHKIIACAIVIGIILHAGDHLACDFPRLVNSSPEKFALISSDFNNRKPTYTDLLSGVEGVTGIAMLVLMAISFTLATHRFRRNIVRLPAPFNRLTGFNAFWYSHHLLGVVYVLLLIHGTFLFLVHEWYKKTTWMYISIPLLLYILERSMRACRSNHYAVRILKVSVLPGNVFSIIMSKPQGFKYRSGQYIFLQCPTISPFEWHPFSITSAPGDDYLSVHIRTVGDWTQELKKTLTEGRDSSCVIGRAKFTSVGCINQTGQPKLLVDGPYGAPAQDYRNYDVLLLVGLGIGATPFVSILRDLLSNTRAEEQDSITETSRSDDSTNSFASSNVTPGSKRKSQRTSSAHFYWVTRESGSFEWFKGVMNEVAEMDHKGQIELHNHLTSVYEEGDARSTLITMVQALNHAKHGFDILSGTRVRTHFGRPNWREVFIKVASKHPYTTVGVFYCGMPMLAKELRKLSHELSHKTSTRFEFHKELF

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from kazusa. 5' end is missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GAGGCGCGGAGGGCGAGGGCGCAGCTGGACCGGAGCCGGTCGAGCGCGCAGAGGGCGCTGAAGGGTCTCCGGTTCATCAGCAAGGCCAACTTCTGCGCCAGGGACGCCGAGGAGCTCTGG
CGCCAGGTCGAGGCTCGCTTCCACCGCCTCGCCAGGGACGGCCTGCTCGCCCGCGAGGACTTCGGCGAATGCATCG
GTACGTTCTCCAAATCCCATCGCCCCATTCATCGATGCATGCGA
GACGTAGTGAAATGTGTCCGGACGGGTTGCGAAGGAAGTTGACGGTTGGCGGCGGTGGTTTTGCTTTGCTGTTGGAAACCAGGGATGGACTCGAAGGAGTTCGCGGTGGGGATGTTCGAC
GCGCTGGCGCGGCGGCGGCGGCAGAGGATCGGGAAGATCACCAGGGAGGAGCTGCACGACTTCTGGCTCCAAATCTCCGACCAGAGCTTCGACGCGCGGCTTCAAATATTCTTCGACAT
G
TGGGCCCCCCTCTCCCTGTCTCTCTTTATCTCTCGATTCGTCTAGCCGTTTTGTGACCGTTCGATCGGATCGGAGCGATGGCTTCCTGGCCTCGTTGACCGTGCCTTTTCGATCGATCTG
ACGGCGGGGGATGCGGAATCCGAGGCAGGCCCGGCCGCCCCCTGGCCGCATGATCTTGCCCGAGGTTTCCGGCGGTCATCTCTCGGGATGATCGCCGGCGTATTAATAGCCTGACAGAAA
GAAAAGACGAGAAGTGTCGTTGAAGCTTTAATTTACTTGTCGGACTCTATTGATTATTATTACCCGCGAAAAATGAAGTACATTGAATGGATTTTGTCCAAATGGATTTTTGGTAGTGAA
TTTCGTGATTTTGAGTGTACCCTTTTTTTGTCTTTTTACGTGTGATCAACTCGTTGAAAATTAGAATTTATACACCAAGAGTAGCGGTTACACTAAGAATAGCAGTCCTTGCTAGAGTTA
TTGTTGTCTTGGTTGGGGCTTATGTCGTCGATAATTGTTGGGAATTTCTGCTTTCTTGGGTCATGAAAAAATTTAATGCTTTCATTAAAAATGGAGAGGAAAATCTTAGTTATTTTTTTG
CGTATTTGAACTAGATTTAGTGTACCTCCTCAATTTACTTGGTAATTCATGTAACTTGACAAATGCCCTAAAAGCCCTGATGAAAAGTCCTGACGTGTGTGTATCCTTTGTGCTTCATTA
GGGCGGACAGCAATGAAGATGGGAGAATCACCAGGGCAGAAGTACAGGAGGTAGGACTTTGTTCTTCCTCATCTGCAATTTCGAGTTTTGTCATCACATTACTCGAGCGTTATCAGCAGC
GTGTCGTCCTTCTTTTAAGCTTGTCCATGTAGACATGAATGGTACTTCCGGCTCACTAGCGAGATGATGCATCGGTTGTAGCTAAGAAAGAATGAACTGTTTCGTTTTACCGACACTTTG
GAGCTTCACCAATGTCTTGATTTCAGCTTCTGATGCTCAGTGCATCAGCTAACAAGTTGTCGAAGCTGAAAGAGCGAGCGGAGGAATACGCCTCCCTGATCATGGAGGAACTGGACCCGG
AGAACCTCGGCTACATCGAG
GTAAAAGCCCCTGAAGCGGCAAAGCAAAACATAGATGACATAGGATATTCAACTTAGGAAAACTCTTTGCTCCATGGAAAAAGTACTAATTCAGACAGGC
TATCATTTGCCCTGTCCTCTGTTTCAGTTGTGGCAACTGGAGACTCTGCTTCTGCAAAAGGACACTTATATGAACTACAGCCGAACGCTCAGCACGACCAGTGTTGGCTGGAGCCAAAAC
CTGAGCTCGTTTAGACCGACCGATAAGGTGCGGAGGATTTGCAGCTCCCTCCGATGCCTCGTGCTGGAGAACTGGCAAAGAGGTTGGATTCTGTTACTTTGGGCGATAGTGATGGGGTGC
CTCTTCGCTTGGAAGTTCATCCAATACAGGAACATGGCAGCATTTCATGTAATGGGCTATTGCCTGGCGACGGCCAAGGGGGCAGCAGAAACTCTGAAGCTCAACATGGCTCTCATCCTC
CTGCCCGTCTGCCGGAACACCCTGACGTGGCTCCGGTCCACCCGAGCCAGGTCGTTGATTCCCTTCGATGACAACATAAACTTCCACAAG
GTAAAAGATCTGGCGAAACAAGTAGAAACA
TCATGCATAGAGTTTTGAAATGTTGGTTCTCAACATCGTATCAATTGCTCCTGGCTGAATTAAATTGGCATGATTCGAAAACATAGTTTTTCCCAAGAATGGAGCTTGAAATTCACTATG
GCAAGTAATAGAAGTAGAAGATTTAGAAAGAAAGTCTAAAGATTTCAATGGTTGCAACTTCCAGGGAATGCAATTCCATTAACATGCATGAGCTAAAGTGCATATGAACATGGCAAAGAT
ATAAAGGAAGTACAGTTGTTCAAAGTGATTATTTCAAGCACTACTGTATTTTAGACCAACTATATCTCGTGTATGCAAGAGATAATGGAATGACACTCCCGCACTTTTTTCCCAATGCAC
AGATAATTGCATGTGCCATAGTCATCGGGATCATCCTTCACGCAGGAGACCATCTAGCATGTGATTTTCCCCGCCTGGTAAACTCCTCCCCAGAAAAGTTTGCCCTCATATCCTCTGACT
TCAATAACAGAAAGCCCACATACACGGACCTTCTATCTGGAGTTGAAGGAGTGACGGGCATTGCTATGCTGGTTTTGATGGCTATCTCATTCACTCTAGCGACACACCGGTTCAGGAGAA
ACATAGTGAGGCTACCTGCACCTTTCAACAGATTGACAGGCTTCAATGCATTCTGGTATTCCCATCACCTGCTAGGTGTGGTCTACGTTTTGCTGCTCATCCATGGAACCTTTCTGTTCT
TGGTGCACGAATGGTACAAGAAAACG
GTAAGCAATCCGTCTCATTGTATATGCTGTAGTTAAGTCAAGACATCAAACTTCATCATGTATTCAATAGCACCGGTACTAATTCGATGCCTTA
CTCACCTCAGACATGGATGTACATCTCTATTCCATTGTTGCTTTACATACTTGAGAGAAGCATGCGAGCATGCAGATCAAACCATTATGCAGTTCGAATATTGAAGGTAATACCTTTCTT
ATTTCTCTTACATTTTGACTTTTCATTGTTTGATCAAGACATAATATAATGCACAATTGAGAAAAAAATGCATCAGCGTCTTCATGCATGATCTTCGCAAAGTACATCGAGAAATTTGTT
TTTCTGAAAAAAGCTAATTTCTTTTGGACTATGTTTGTTCTCTTCAGGTTTCGGTACTACCAGGGAATGTCTTCAGCATAATCATGTCCAAGCCTCAAGGGTTCAAGTACAGAAGCGGGC
AGTACATTTTTCTACAATGTCCGACAATTTCCCCTTTTGAGTG
GTAAAGTCCAAAACTCATCTCACCTCCTAGCTTTTCCAACATCTGCATTTCCACCATCAAAGGCTAAGTGCTGATAC
CTTCCAGGCACCCATTCTCAATTACTTCAGCACCTGGAGATGACTACCTCAGTGTTCACATCAGGACAGTTGGTGATTGGACACAGGAGTTGAAAAAAACTCTCACTGAAGGCAGAGACT
CGTCATGTGTCATTGGCCGAGCAAAATTCACATCGGTTGGTTGTATCAATCAGACAGG
GTAATTATGTTTCTGGCAGGCTTAAGTTCCGAAATAGAAACTATTCTAGGTAATGCTAACTG
AACAAACTGTCATGTCATGATGCAGCCAACCCAAATTGCTCGTCGATGGTCCATACGGAGCTCCAGCTCAGGACTACAGAAATTATGATGTACTTCTCCTCGTGGGGCTTGGCATTGGTG
CAACCCCTTTTGTAAGCATCCTTAGAGATCTTCTGAGTAATACAAGAGCAGAGGAGCAAATG
GTACAGTATGTTGCTAATATATGAACAACGTGTCTTCAAATTTAGGAAACACATCCTA
AACTTTTGCTATTGTGATGAACTAGGATTCAATCACAGAGACCAGTAGATCTGATGATAGCACAAATAGTTTCGCATCTTCAAACGTGACACCAGGCAGCAAAAGAAAGTCACAGAGGAC
GTCCAGTGCTCATTTCTACTGGGTGACTAGGGAATCCGGGTCGTTCGAGTGGTTCAAAGGAGTCATGAATGAAGTTGCAGAAATGGATCACAAA
GTAAAATTCTTCTGAACATTGCTCAT
GACTGTTTAGTGCACGTGTAGAAGGAACTAAATGAGCGGGCTAAGAGACCCTATGTCTTCTCTCTCTTTCTGTATGAGCAGGGTCAAATTGAGCTTCACAATCACCTTACCAGTGTCTAT
GAAGAGGGAGATGCAAGGTCAACTCTAATCACCATGGTCCAGGCTCTCAATCATGCCAAACACGGTTTCGACATCCTATCGGGGACACGG
GTATAATATGATGTCTACATAACAATGCCA
CATTCCGTTACGTTACCATGTTAACAATGAACACGCTACCGAGACAATTGACTAGAGACACTATAGATAGAATATTCTTCTCTATTTTTTAGCTCGTTTGTTAAAGTGAACTGCTTCAAC
CGTGAGGCTGCTAACTCAGTCCTGATATTCGATACTTGCAGGTAAGAACACACTTTGGAAGACCGAATTGGAGAGAGGTATTTATCAAAGTAGCTTCAAAGCATCCATACACTACAGTAG
GTAAGTGTAAAACAAGAAAGCATTAGTACTTGCTGACAAATTTCATAACAATCAAACTAAGTAGTTCAGATCCCAGATACAATGAAATTACAAAAACTAGCTTCATTTGTTGCTGGTAAT
TAATCCTGAAATCATCATACAGGTAGAGCTCAGCACAATAGCCTTCTGATATTAACAATAACTAGACAAGACTTACAAATTGACATTAGGTCAGATGTAACTTCTGCAAATAAAAGACTT
GTTTTTAAACTTGTAGGAGACCCTTATACGCACTCTGTGGCCAAGTCTACATCAGAAAATAATGCGAAGGATCAAAATATAAGATCTTAACTTCTGCGTAAATTATATAATAAAACCCTT
TGACTAGGAAAGTAAAACCATCTCCTTAACGTAATGAAACTCTACAGTGTTTGCTGAATCTGCAACTGTGCAAGATACTGACGTTTCAATGATGTCTGAACGAAAGGGGTTTTTCTATTG
CAGGGGTGTTCTACTGCGGGATGCCGATGTTAGCAAAGGAATTAAGGAAGCTATCGCATGAGCTGAGTCACAAGACATCTACACGTTTCGAATTCCACAAGGAGCTTTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GAGGCGCGGAGGGCGAGGGCGCAGCTGGACCGGAGCCGGTCGAGCGCGCAGAGGGCGCTGAAGGGTCTCCGGTTCATCAGCAAGGCCAACTTCTGCGCCAGGGACGCCGAGGAGCTCTGG
CGCCAGGTCGAGGCTCGCTTCCACCGCCTCGCCAGGGACGGCCTGCTCGCCCGCGAGGACTTCGGCGAATGCATCG
GGATGGACTCGAAGGAGTTCGCGGTGGGGATGTTCGACGCGCTG
GCGCGGCGGCGGCGGCAGAGGATCGGGAAGATCACCAGGGAGGAGCTGCACGACTTCTGGCTCCAAATCTCCGACCAGAGCTTCGACGCGCGGCTTCAAATATTCTTCGACAT
GGCGGAC
AGCAATGAAGATGGGAGAATCACCAGGGCAGAAGTACAGGAG
CTTCTGATGCTCAGTGCATCAGCTAACAAGTTGTCGAAGCTGAAAGAGCGAGCGGAGGAATACGCCTCCCTGATCATG
GAGGAACTGGACCCGGAGAACCTCGGCTACATCGAG
TTGTGGCAACTGGAGACTCTGCTTCTGCAAAAGGACACTTATATGAACTACAGCCGAACGCTCAGCACGACCAGTGTTGGCTGG
AGCCAAAACCTGAGCTCGTTTAGACCGACCGATAAGGTGCGGAGGATTTGCAGCTCCCTCCGATGCCTCGTGCTGGAGAACTGGCAAAGAGGTTGGATTCTGTTACTTTGGGCGATAGTG
ATGGGGTGCCTCTTCGCTTGGAAGTTCATCCAATACAGGAACATGGCAGCATTTCATGTAATGGGCTATTGCCTGGCGACGGCCAAGGGGGCAGCAGAAACTCTGAAGCTCAACATGGCT
CTCATCCTCCTGCCCGTCTGCCGGAACACCCTGACGTGGCTCCGGTCCACCCGAGCCAGGTCGTTGATTCCCTTCGATGACAACATAAACTTCCACAAG
ATAATTGCATGTGCCATAGTC
ATCGGGATCATCCTTCACGCAGGAGACCATCTAGCATGTGATTTTCCCCGCCTGGTAAACTCCTCCCCAGAAAAGTTTGCCCTCATATCCTCTGACTTCAATAACAGAAAGCCCACATAC
ACGGACCTTCTATCTGGAGTTGAAGGAGTGACGGGCATTGCTATGCTGGTTTTGATGGCTATCTCATTCACTCTAGCGACACACCGGTTCAGGAGAAACATAGTGAGGCTACCTGCACCT
TTCAACAGATTGACAGGCTTCAATGCATTCTGGTATTCCCATCACCTGCTAGGTGTGGTCTACGTTTTGCTGCTCATCCATGGAACCTTTCTGTTCTTGGTGCACGAATGGTACAAGAAA
ACG
ACATGGATGTACATCTCTATTCCATTGTTGCTTTACATACTTGAGAGAAGCATGCGAGCATGCAGATCAAACCATTATGCAGTTCGAATATTGAAGGTTTCGGTACTACCAGGGAAT
GTCTTCAGCATAATCATGTCCAAGCCTCAAGGGTTCAAGTACAGAAGCGGGCAGTACATTTTTCTACAATGTCCGACAATTTCCCCTTTTGAGTG
GCACCCATTCTCAATTACTTCAGCA
CCTGGAGATGACTACCTCAGTGTTCACATCAGGACAGTTGGTGATTGGACACAGGAGTTGAAAAAAACTCTCACTGAAGGCAGAGACTCGTCATGTGTCATTGGCCGAGCAAAATTCACA
TCGGTTGGTTGTATCAATCAGACAGG
CCAACCCAAATTGCTCGTCGATGGTCCATACGGAGCTCCAGCTCAGGACTACAGAAATTATGATGTACTTCTCCTCGTGGGGCTTGGCATTGGT
GCAACCCCTTTTGTAAGCATCCTTAGAGATCTTCTGAGTAATACAAGAGCAGAGGAGCAAATG
GATTCAATCACAGAGACCAGTAGATCTGATGATAGCACAAATAGTTTCGCATCTTCA
AACGTGACACCAGGCAGCAAAAGAAAGTCACAGAGGACGTCCAGTGCTCATTTCTACTGGGTGACTAGGGAATCCGGGTCGTTCGAGTGGTTCAAAGGAGTCATGAATGAAGTTGCAGAA
ATGGATCACAAA
GGTCAAATTGAGCTTCACAATCACCTTACCAGTGTCTATGAAGAGGGAGATGCAAGGTCAACTCTAATCACCATGGTCCAGGCTCTCAATCATGCCAAACACGGTTTC
GACATCCTATCGGGGACACGG
GTAAGAACACACTTTGGAAGACCGAATTGGAGAGAGGTATTTATCAAAGTAGCTTCAAAGCATCCATACACTACAGTAGGGGTGTTCTACTGCGGGATG
CCGATGTTAGCAAAGGAATTAAGGAAGCTATCGCATGAGCTGAGTCACAAGACATCTACACGTTTCGAATTCCACAAGGAGCTTTTCTGA

Retrieve as FASTA