Entry information : PinvLDS02
Entry ID 10638
Creation 2012-03-02 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-11 (Catherine Mathe)
Peroxidase information: PinvLDS02
Name PinvLDS02
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Paxillaceae Paxillus
Organism Paxillus involutus    [TaxId: 71150 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PinvLDS02
start..stop
S start..stop
SbreLDS02 1490 0 3..1055 2..1068
SlutLDS02 1479 0 3..1055 2..1067
LbiLDS02 1135 0 62..1054 51..1018
GluxLDS02 1133 0 2..1054 6..1054
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1110473..1110526 54 N° 2 1110586..1110675 90 N° 3 1110728..1110766 39 N° 4 1110822..1110878 57
N° 5 1110940..1111021 82 N° 6 1111072..1111283 212 N° 7 1111339..1111510 172 N° 8 1111569..1111672 104
N° 9 1111722..1111821 100 N° 10 1111881..1112065 185 N° 11 1112114..1112295 182 N° 12 1112352..1112414 63
N° 13 1112471..1112610 140 N° 14 1112668..1113235 568 N° 15 1113291..1113516 226 N° 16 1113572..1113657 86
N° 17 1113707..1113824 118 N° 18 1113875..1114031 157 N° 19 1114087..1114209 123 N° 20 1114257..1114375 119
N° 21 1114431..1114739 309  
join(1110473..1110526,1110586..1110675,1110728..1110766,1110822..1110878,1110940 ..1111021,1111072..1111283,1111339..1111510,1111569..1111672,1111722..1111821,11 11881..1112065,1112114..1112295,1112352..1112414,1112471..1112610,1112668..11132 35,1113291..1113516,1113572..1113657,1113707..1113824,1113875..1114031,1114087.. 1114209,1114257..1114375,1114431..1114739)


exon

Literature and cross-references PinvLDS02
DNA ref. JGI genome:   scaffold_2 (1110473..1114739)
Cluster/Prediction ref. JGI gene:   6692
Protein sequence: PinvLDS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1062
PWM (Da):   %s   118156.89  
PI (pH):   %s   5.96
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSVLNRTFSSRFSTKSPVSSPVSPTTEHSASSSSEPGTNKALAAIKDLMKRAAEDINESTLSAVLDVVEHSGSIDDRKMLLEHILTFMSNHPTGKVQDLAQTYIIKTLYNDLAHPPATFVGPEYAFRTADGSGNNPEFPSLGKAGTAYARSVQQANPLPRNQMPDAGLVFDTLLRRDFRKHPAGLSALMFSFAALVIHSVFRTDHKNPSINMTSGYVDLAPLYGNDQATQDKARNGRGCLHPDTFAEDRLLLLPPATAVILVLFNRNHYIARRLLEINERGTWVDPSKLPPNSAKLQKQEEEIFQITRLCNCAWFATVIFSDYFSAILGLVRQGSTWSLAPFNEIRTDHVLFERGRGNACSVFNCLYRWHATTSQEDEEWIKLQFAKVFPGKDPEKLTVSDFYKTEAILEANEPGVEQWTFDNLQRQADGSFHDSDLANILQNSTSHHAAAFGARGTPAIMRVNEIMGIESNRQWGVCSLNDFRKFLGLTYSNFYEWNPNPEVAEAAKKLYGNIDNLELYVGLQAEDTKPVMDGTGLCPGYTISRSILSDAIALTRGDRFFTEDYTPYNMTAWGFADCQRDVNGWGFGSTLGRLFLRTLPNDYDEKSVYTWFPLMHPEAMEENLKNLGKLDDYVLERPKKRTPATTVNNYVEVGEVLKDNSNFVAQSEERAKEVIKGEGFFSASGDVDQVRKEFISALAPSPAAIDKIGQYFYTKSSELIAASSYSLINTNTKSVNIIRDVLKVVPVYWAASEAGIPLKDKQHPHGVYTPQELYDILGEIYQFIFLDVEPAKYMASKQKVQGYIEELSHHIKASFGGAGNLSLAGIFGTIFGKKKNGHNELLKRLFELGHSNDQVVNEILALMIGVTVEVSLALTNVVNLLLDSEEGATFRTQARSVDTKDVNALEAYVVEALRIDPPFAGVYRVAKKEHTVESLAVQQGEHLFLDVASAGMEEAFPNPTTFDATRTPRERYLRADVAFKAIGADIAWKPVVQVLRSILAFDNVRRGPGQSGKLARFEDSSIQYLRYVYLDAQQIRSPWPTSLVILYDVPASSA*

Retrieve as FASTA  
Remarks Complete seqeunce from genomic (20 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGTACTCAACAGGACCTTCTCTTCGCGTTTCTCAACCAAGAGCCCGGTCGTGAGTCTTATGTCCTCATCATGCGTCACAACCTTCAGCTAATCCGACCTTTTGCTTAGTCTAGTC
CGGTGTCGCCCACCACAGAGCACAGCGCCTCTTCGTCGAGCGAGCCTGGGACCAACAAGGCACTTGCAGCTATCAAAGACCTG
GTTAGTAGGCGACTTCGAGCCTAGACATTCCCAAGTT
CTGACGTCCTTCCAGATGAAGCGTGCTGCTGAGGATATTAATGAATCGACACTCGTGAGTTTGGCTTCATGATTTGGCGTTATATGCGGTTAACTCGCTCCTTTACAAGTCTGCTGTTCT
TGATGTCGTGGAGCACTCTGGCTCCATCGATGACAGGAAGATGTTG
GTAAGTCGCCCAGACAACTCTGCACATCATCCATGACGTCCTTCTCACTGTAACACACTAGCTTGAGCATATCC
TGACTTTCATGTCCAATCACCCAACTGGCAAAGTTCAGGACCTCGCCCAGACCTATATCATTAAGACAC
GTCAGTACCAGCGCGGATGTCATTTTGACCGCTATTTACCTTGTTATTAGT
GTACAATGATCTTGCCCATCCTCCCGCGACATTCGTTGGCCCCGAGTACGCGTTCCGCACGGCGGACGGGTCTGGCAACAACCCTGAATTTCCAAGCTTGGGCAAGGCTGGGACTGCTTA
TGCGCGTTCTGTGCAGCAGGCCAACCCGCTCCCACGCAACCAGATGCCCGATGCTGGATTGGTATTCGATACTCTGCTGCGTCGCGACGAG
GTAAGGTTCCATTGTGCAACTGGATGTTA
GCAGGCGCTGAATATGTATTTTCCAGTTCCGGAAGCACCCCGCCGGGTTATCTGCGTTGATGTTCTCCTTTGCCGCGCTTGTCATTCACAGCGTGTTCCGTACCGATCACAAGAATCCGA
GCATCAACATGACCTCTGGTTACGTCGATCTTGCGCCTCTGTACGGCAACGACCAAGCCACGCAGGACAAGGCACGGA
GTCGCGATTCTAAATCCCGTCAATATACGCTGATAGGTGATG
CAGATCCGGATCAAAGACGGCCGTGGATGTCTCCACCCCGATACCTTTGCCGAGGATCGTTTGCTCCTCCTTCCTCCTGCGACCGCAGTCATCCTGGTGTTGTTCAACCGTAACCACAAC
GTAAGCCTGCAGTTCTGAGACATTGATAACACTGATCATCACTACGTAGTACATCGCTCGCCGTCTCTTGGAGATCAATGAGCGGGGAACTTGGGTTGATCCTTCCAAGTTACCCCCAAA
CTCTGCTAAGTTGCAGAAGCAGGAGGAAG
GTTCGCCTACTTCCTGATTTTGTAGTTGTCTGCCAATCTAACGCCTGCCCGCCTGGCAGAAATTTTCCAGATCACTCGCCTCTGTAACTGT
GCCTGGTTCGCCACAGTCATATTCTCCGACTACTTCTCCGCTATCCTTGGCCTTGTCCGCCAGGGTTCCACCTGGAGTTTGGCGCCATTCAACGAAATTCGTACCGATCACGTACTGTTC
GAGCGTGGCCGTGGTAACGCCTGCAGTGTTGAG
GTTCGTGGTGAAGTTGACAATTGACGCACACTGACCGGCCATCAACAGTTCAATTGTTTGTACAGATGGCACGCAACAACTTCCCAA
GAAGACGAGGAGTGGATCAAGCTCCAGTTTGCGAAGGTCTTCCCCGGAAAGGACCCTGAAAAACTGACGGTCTCAGATTTCTACAAGACGGAGGCCATACTGGAGGCTAACGAACCTGGT
GTCGAGCAGTGGACGTTTGACAA
GTAAGTTGTGCCCTCCATCCAGGTTCTTGGCAATATCTAACTTGGTCAACGCGCAGCTTGCAGCGCCAGGCGGACGGTTCTTTCCATGATTCCGACC
TCGCGAACATTTTGCAGAACTC
GTGCGTATCTGCACGATTGTGTGGACTGCACAACAACTAATTTCTGGTGCGATCAGGACTTCCCACCATGCGGCTGCCTTTGGTGCTCGTGGTACTCC
CGCGATCATGCGTGTGAATGAGATCATGGGTATCGAGTCCAATCGCCAATGGGGTGTTTGCTCGCTCAACGACTTCCGCAAGTTCCTGGGCTTGAAGA
GTAAGCATACACCAAATATATA
TAGTGATAGGAGATGAGCTGATTTACCTTGACTAGCCTACTCCAACTTCTACGAATGGAACCCCAACCCAGAGGTCGCAGAAGCCGCCAAGAAGCTTTATGGAAACATCGATAACTTGGA
GTTGTACGTTGGTCTCCAAGCCGAGGACACCAAGCCCGTCATGGACGGTACAGGACTTTGCCCTGGTTACACAATCTCTCGCTCCATCCTCTCGGACGCCATCGCCCTCACTCGTGGTGA
CCGTTTCTTCACAGAGGACTACACTCCTTACAACATGACAGCATGGGGCTTCGCGGATTGCCAGCGTGATGTCAATGGCTGGGGCTTCGGGTCCACTCTTGGACGTCTGTTCCTCCGCAC
GTTGCCTAACGACTACGATGAGAAATCCGTGTACACTTGGTTCCCACTCATGCACCCTGAGGCCATGGAGGAGAACCTCAAGAACCTCGGCAAGCTCGATGATTACGTGCTTGAACGTCC
CAAGAAACGCACCCCAGCCACAACTGTCAATAACTACGTCGAGGTTGGTGAGGTGCTCAAGGACAACAGTAACTTCGTTGCACAGTCCGAAGAGCGCGCCAAGGAAGTCATCAAGGGCGA
GGG
GTGAGCAGCACAGACTTCCTGGTGATCTGAGTGTTGATAAGTTGTTACGCAACAGTTTCTTCTCTGCGTCTGGCGATGTTGACCAAGTGCGGAAGGAGTTCATCAGTGCATTGGCTC
CTTCCCCGGCGGCCATCGACAAGATTGGACAGTACTTCTACACAAAATCTTCGGAGCTGATTGCGGCTAGTTCGTACTCCTTGATTAACACGAACACCAAGAGTGTCAACATCATCCGTG
ACGTCCTGAAGGTTGTCCCTGTCTACTGGGCCGCATCTGAAGTG
GTGCGTTACCTGTGAATGCACAATTGTGTTTTTATTTACCATGTTGTCTGCTTAGGCTGGAATCCCGCTCAAGGAC
AAACAGCACCCCCATGGTGTTTACACTCCCCAGGAATTGTACGACATTCTGGGTGAAATTTACCA
GTAAGGGCAGTCCTACCTGATGTTGTCAGCAGTACTGAGCTGGGTGCAGGTTCAT
CTTCCTTGATGTTGAGCCTGCCAAGTATATGGCGTCGAAGCAGAAGGTCCAAGGATACATCGAGGAACTTTCTCACCACATCAAGGCTTCCTTTGGCGGTGCCGGAAACAGG
GTAAGTGG
TTGGTTTCCGTTTCAACGATGCCACTCACTCTCCCATTTCAGCTGTCTCTCGCTGGTATCTTTGGAACCATCTTTGGTAAGAAGAAGAATGGACATAATGAGTTGTTGAAGCGCCTCTTC
GAGCTTGGTCACTCTAATGACCAAGTCGTCAACGAGATTTTGGCCCTCATGATCGGCGTTACAGTCGAGGTGTCACTCG
GTAGGCGTAAACTGGCTATCCAGTGTGGCGGTTGACATTTA
CCTTTGACATATAGCCTTGACCAATGTCGTCAACCTCCTTCTCGACTCTGAGGAGGGTGCGACGTTCCGCACTCAGGCTAGGAGCGTTGACACGAAGGATGTTAATGCTCTTGAAGCATA
TGTCGTCGAAGCTCTGA
GTTAGTGCAACGTCTCAAGCATGGAACAACTTCTGACCTCTTTGTAGGGATTGATCCTCCCTTTGCCGGGGTGTACCGCGTTGCCAAGAAGGAACACACCGTC
GAGTCTCTCGCAGTTCAACAGGGCGAGCATCTCTTTTTGGATGTCGCTAGTGCCGGCATGAGT
GTACGCAGTTAATATTTTCTTCGGATATCCTCCCATTCTCACATCTTGGCAACAGGA
GGAGGCATTCCCTAACCCCACCACTTTCGATGCGACCCGTACGCCGCGTGAACGCTACCTCCGAGCAGATGTGGCGTTCAAGGCCATCGGTGCCGACATTGCTTGGAAGCCTGTTGTCCA
AGTGCTCAGGAGCATTCTCGCCTTTGATAACGTCCGTCGTGGTCCTGGCCAGTCTGGCAAGCTTGCTCGCTTCGAGGACTCTTCCATCCAGTACCTACGCTACGTCTACTTGGATGCACA
GCAGATCCGCAGCCCCTGGCCTACATCTTTGGTGATCTTGTACGATGTTCCTGCTTCGAGTGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGTACTCAACAGGACCTTCTCTTCGCGTTTCTCAACCAAGAGCCCGGTCTCTAGTCCGGTGTCGCCCACCACAGAGCACAGCGCCTCTTCGTCGAGCGAGCCTGGGACCAACAAG
GCACTTGCAGCTATCAAAGACCTG
ATGAAGCGTGCTGCTGAGGATATTAATGAATCGACACTCTCTGCTGTTCTTGATGTCGTGGAGCACTCTGGCTCCATCGATGACAGGAAGATGTTG
CTTGAGCATATCCTGACTTTCATGTCCAATCACCCAACTGGCAAAGTTCAGGACCTCGCCCAGACCTATATCATTAAGACACTGTACAATGATCTTGCCCATCCTCCCGCGACATTCGTT
GGCCCCGAGTACGCGTTCCGCACGGCGGACGGGTCTGGCAACAACCCTGAATTTCCAAGCTTGGGCAAGGCTGGGACTGCTTATGCGCGTTCTGTGCAGCAGGCCAACCCGCTCCCACGC
AACCAGATGCCCGATGCTGGATTGGTATTCGATACTCTGCTGCGTCGCGACGAG
TTCCGGAAGCACCCCGCCGGGTTATCTGCGTTGATGTTCTCCTTTGCCGCGCTTGTCATTCACAGC
GTGTTCCGTACCGATCACAAGAATCCGAGCATCAACATGACCTCTGGTTACGTCGATCTTGCGCCTCTGTACGGCAACGACCAAGCCACGCAGGACAAGGCACGGA
ACGGCCGTGGATGT
CTCCACCCCGATACCTTTGCCGAGGATCGTTTGCTCCTCCTTCCTCCTGCGACCGCAGTCATCCTGGTGTTGTTCAACCGTAACCACAAC
TACATCGCTCGCCGTCTCTTGGAGATCAAT
GAGCGGGGAACTTGGGTTGATCCTTCCAAGTTACCCCCAAACTCTGCTAAGTTGCAGAAGCAGGAGGAAG
AAATTTTCCAGATCACTCGCCTCTGTAACTGTGCCTGGTTCGCCACAGTC
ATATTCTCCGACTACTTCTCCGCTATCCTTGGCCTTGTCCGCCAGGGTTCCACCTGGAGTTTGGCGCCATTCAACGAAATTCGTACCGATCACGTACTGTTCGAGCGTGGCCGTGGTAAC
GCCTGCAGTGTTGAG
TTCAATTGTTTGTACAGATGGCACGCAACAACTTCCCAAGAAGACGAGGAGTGGATCAAGCTCCAGTTTGCGAAGGTCTTCCCCGGAAAGGACCCTGAAAAACTG
ACGGTCTCAGATTTCTACAAGACGGAGGCCATACTGGAGGCTAACGAACCTGGTGTCGAGCAGTGGACGTTTGACAA
CTTGCAGCGCCAGGCGGACGGTTCTTTCCATGATTCCGACCTC
GCGAACATTTTGCAGAACTC
GACTTCCCACCATGCGGCTGCCTTTGGTGCTCGTGGTACTCCCGCGATCATGCGTGTGAATGAGATCATGGGTATCGAGTCCAATCGCCAATGGGGTGTT
TGCTCGCTCAACGACTTCCGCAAGTTCCTGGGCTTGAAGA
CCTACTCCAACTTCTACGAATGGAACCCCAACCCAGAGGTCGCAGAAGCCGCCAAGAAGCTTTATGGAAACATCGATAAC
TTGGAGTTGTACGTTGGTCTCCAAGCCGAGGACACCAAGCCCGTCATGGACGGTACAGGACTTTGCCCTGGTTACACAATCTCTCGCTCCATCCTCTCGGACGCCATCGCCCTCACTCGT
GGTGACCGTTTCTTCACAGAGGACTACACTCCTTACAACATGACAGCATGGGGCTTCGCGGATTGCCAGCGTGATGTCAATGGCTGGGGCTTCGGGTCCACTCTTGGACGTCTGTTCCTC
CGCACGTTGCCTAACGACTACGATGAGAAATCCGTGTACACTTGGTTCCCACTCATGCACCCTGAGGCCATGGAGGAGAACCTCAAGAACCTCGGCAAGCTCGATGATTACGTGCTTGAA
CGTCCCAAGAAACGCACCCCAGCCACAACTGTCAATAACTACGTCGAGGTTGGTGAGGTGCTCAAGGACAACAGTAACTTCGTTGCACAGTCCGAAGAGCGCGCCAAGGAAGTCATCAAG
GGCGAGGG
TTTCTTCTCTGCGTCTGGCGATGTTGACCAAGTGCGGAAGGAGTTCATCAGTGCATTGGCTCCTTCCCCGGCGGCCATCGACAAGATTGGACAGTACTTCTACACAAAATCT
TCGGAGCTGATTGCGGCTAGTTCGTACTCCTTGATTAACACGAACACCAAGAGTGTCAACATCATCCGTGACGTCCTGAAGGTTGTCCCTGTCTACTGGGCCGCATCTGAAGTG
GCTGGA
ATCCCGCTCAAGGACAAACAGCACCCCCATGGTGTTTACACTCCCCAGGAATTGTACGACATTCTGGGTGAAATTTACCA
GTTCATCTTCCTTGATGTTGAGCCTGCCAAGTATATGGCG
TCGAAGCAGAAGGTCCAAGGATACATCGAGGAACTTTCTCACCACATCAAGGCTTCCTTTGGCGGTGCCGGAAACAGG
CTGTCTCTCGCTGGTATCTTTGGAACCATCTTTGGTAAGAAG
AAGAATGGACATAATGAGTTGTTGAAGCGCCTCTTCGAGCTTGGTCACTCTAATGACCAAGTCGTCAACGAGATTTTGGCCCTCATGATCGGCGTTACAGTCGAGGTGTCACTCG
CCTTG
ACCAATGTCGTCAACCTCCTTCTCGACTCTGAGGAGGGTGCGACGTTCCGCACTCAGGCTAGGAGCGTTGACACGAAGGATGTTAATGCTCTTGAAGCATATGTCGTCGAAGCTCTGA
GG
ATTGATCCTCCCTTTGCCGGGGTGTACCGCGTTGCCAAGAAGGAACACACCGTCGAGTCTCTCGCAGTTCAACAGGGCGAGCATCTCTTTTTGGATGTCGCTAGTGCCGGCATGAGT
GAG
GAGGCATTCCCTAACCCCACCACTTTCGATGCGACCCGTACGCCGCGTGAACGCTACCTCCGAGCAGATGTGGCGTTCAAGGCCATCGGTGCCGACATTGCTTGGAAGCCTGTTGTCCAA
GTGCTCAGGAGCATTCTCGCCTTTGATAACGTCCGTCGTGGTCCTGGCCAGTCTGGCAAGCTTGCTCGCTTCGAGGACTCTTCCATCCAGTACCTACGCTACGTCTACTTGGATGCACAG
CAGATCCGCAGCCCCTGGCCTACATCTTTGGTGATCTTGTACGATGTTCCTGCTTCGAGTGCTTGA

Retrieve as FASTA