Entry information : GluxAPx-CcP01
Entry ID 10644
Creation 2012-03-02 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: GluxAPx-CcP01
Name GluxAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Gymnopus
Organism Gymnopus luxurians    [TaxId: 206324 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GluxAPx-CcP01
start..stop
S start..stop
GluxAPx-CcP[P]09 563 0 18..530 17..510
GluxAPx-CcP07 558 0 7..534 4..510
GluxAPx-CcP08 558 0 2..530 1..509
GluxAPx-CcP05 542 0 75..534 1..458
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 465570..465779 210 N° 2 465421..465507 87 N° 3 465299..465365 67 N° 4 464931..465240 310
N° 5 464754..464867 114 N° 6 464525..464699 175 N° 7 464109..464474 366 N° 8 463770..464048 279
complement(join(463770..464048,464109..464474,464525..464699,464754..464867,4649 31..465240,465299..465365,465421..465507,465570..465779))


exon

Literature and cross-references GluxAPx-CcP01
DNA ref. JGI genome:   scaffold_38 (465779..463770)
Cluster/Prediction ref. JGI gene:   45533
Protein sequence: GluxAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   536 (510)
PWM (Da):   %s   58560.84 (55504.3)  
PI (pH):   %s   4.26 (4.21) Peptide Signal:   %s   cut: 26 range:26-535
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLSLNCRTLFFETTLFFSLVHWALGIPTYQWPDPRSRYIDKVLYEDGPDLLVSGCTPRFNSTISAQWLRVMFHDMSTHNVDDGTGGLDASINFELERPQNIGEGQTQSLVDFMPFTTTFFGLADTIAFGAALAVLGCGGPVIPFRAGRIDATSAGPATVPQPQEDLATHIESFRRQGFNITEMISLVACGHTLGGIRHADFPLIVTDNDTDVALFDTTKNFDNVVVSQYLQNTSQDVLVVGPNVTTRSDFRIFSSDGNVTMRSFLNNETFFDTCANLIERMINTVPNGVTLTDPIDPLQYLVYQPLLSYQNGTLIMTTALRLINASDNPSRTITLFWADRRGSFCPSTGCSVQTTGTQFLTTNIYLSAKGYNATKYLFNATINASTSISKFWFEINENDGSQPVAVDNGGSGFSIAQDSVFIDSLRSKTVFTSTDIFLKVVVAVRGDSNATSVAMTTFDPTTPLFNPTPPFLPNITVMNLELDESNPPEGGFTFFSGAATQQVTTVNYTGSVVGGTTFNVNDFDLKSVTFDLEFE

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGTCTTTGAACTGCCGGACTTTGTTCTTTGAAACTACTCTCTTCTTCTCCCTAGTTCACTGGGCGCTTGGAATTCCGACGTATCAATGGCCTGACCCTCGCTCAAGATACATCGAC
AAAGTTCTATACGAGGATGGTCCTGATCTACTTGTATCAGGATGCACACCGCGATTCAATTCTACCATATCGGCACAGTGGCTTCGTGTT
GTAGGTATAGGTCAAGATGGAGCATATAGA
GAAAGTACAACTGATCGCGTTGTATTCTGAAGATGTTTCATGACATGTCGACTCATAATGTAGATGATGGGACTGGGGGGTTGGATGCTTCGATTAATTTTGAGCTCGAAAGACCTCAGG
TGTGCAGAGCCGTTTCTGTTATGGATAGTACCGGAGGTTTCTGACAATGAGCAGAATATTGGAGAGGGACAGACACAATCGTTGGTTGACTTTATGCCCTTTACGACTACGTTCTTCGGG
T
GTATGTTGTACTTAGATTGAGATTGGGAGACTAGGGCTGATCTTGACGTCTTGACTAGTGGCAGATACGATAGCTTTTGGCGCAGCGCTCGCTGTGTTAGGATGTGGAGGGCCTGTCAT
TCCTTTCCGAGCCGGCCGTATTGATGCAACTAGTGCGGGACCAGCGACTGTTCCGCAGCCTCAAGAAGATCTTGCAACGCATATAGAGTCTTTTCGGAGGCAGGGATTCAATATAACGGA
GATGATATCGCTCGTGGCTTGCGGGCATACTCTGGGGGGCATTCGACACGCAGATTTTCCGCTGATTGTTACGGACAATGATACGGATGTTGCGCTGTTTGATACGACGAAGAATTTTGA
TAATGTTGT
GTTCGTACTAGTCACTGTTTATTTTCTGCGCTTCTTGTGCTTACGGAAGTAATTGTTCTTTAGAGTTTCGCAGTATCTGCAAAATACCAGCCAAGATGTGCTTGTCGTAGG
CCCAAATGTCACGACGAGATCGGATTTCCGAATTTTTTCCAGCGATGGAAATGTGACGATGAGAAG
GTATACACTGATCGGGATACGTGATTTATGAAGTGGTCATTGAATTACCTGCAG

CTTCCTCAATAATGAAACGTTCTTCGATACTTGCGCGAATCTCATAGAGAGGATGATCAACACGGTACCCAATGGAGTGACTCTGACGGATCCTATTGACCCCTTACAATACCTCGTCTA
TCAACCGTTGTTATCATATCAAAATGGGACCTTGATCATGACCACTGCGTTACGA
GTACGTATCCCTCATCACACTGCTCAAGCTCACTAATGCAATACCTGTAGCTTATAAATGCAAGT
GACAACCCCAGCCGGACGATAACTCTCTTTTGGGCCGATCGACGAGGGTCATTCTGCCCTTCAACTGGATGCTCTGTACAAACGACTGGTACACAATTCCTTACTACGAACATATATCTC
TCAGCCAAAGGCTATAACGCGACCAAATACCTTTTCAACGCTACTATCAACGCTTCGACTTCGATATCCAAGTTCTGGTTCGAAATAAACGAAAATGACGGGTCTCAACCAGTCGCAGTG
GACAACGGAGGCTCTGGGTTTTCTATCGCACAAGATTCCGTATTCATCGATAGCTTGCGTAGCAAGACTGTGTTTACTTCGACTGATATCTTCCTAAAAGTCGTTGTGGCG
GTATGTCAT
TGTGACTATAGGCTACGGCTAGTCTAAATCTTACCGAGGACTTTTTTATAGGTTCGTGGCGATTCCAACGCGACGAGCGTAGCAATGACTACATTCGATCCGACCACACCGCTCTTCAAT
CCTACGCCTCCTTTCCTCCCCAACATAACTGTCATGAACCTAGAACTTGACGAAAGCAACCCTCCGGAGGGTGGATTTACTTTTTTCTCTGGAGCGGCTACCCAGCAGGTAACAACTGTT
AACTACACAGGAAGTGTCGTGGGAGGAACGACTTTTAACGTGAATGACTTCGATCTCAAATCTGTTACCTTTGATTTGGAGTTCGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGTCTTTGAACTGCCGGACTTTGTTCTTTGAAACTACTCTCTTCTTCTCCCTAGTTCACTGGGCGCTTGGAATTCCGACGTATCAATGGCCTGACCCTCGCTCAAGATACATCGAC
AAAGTTCTATACGAGGATGGTCCTGATCTACTTGTATCAGGATGCACACCGCGATTCAATTCTACCATATCGGCACAGTGGCTTCGTGTT
ATGTTTCATGACATGTCGACTCATAATGTA
GATGATGGGACTGGGGGGTTGGATGCTTCGATTAATTTTGAGCTCGAAAGACCTCAG
AATATTGGAGAGGGACAGACACAATCGTTGGTTGACTTTATGCCCTTTACGACTACGTTCTTC
GGGT
TGGCAGATACGATAGCTTTTGGCGCAGCGCTCGCTGTGTTAGGATGTGGAGGGCCTGTCATTCCTTTCCGAGCCGGCCGTATTGATGCAACTAGTGCGGGACCAGCGACTGTTCCG
CAGCCTCAAGAAGATCTTGCAACGCATATAGAGTCTTTTCGGAGGCAGGGATTCAATATAACGGAGATGATATCGCTCGTGGCTTGCGGGCATACTCTGGGGGGCATTCGACACGCAGAT
TTTCCGCTGATTGTTACGGACAATGATACGGATGTTGCGCTGTTTGATACGACGAAGAATTTTGATAATGTTGT
AGTTTCGCAGTATCTGCAAAATACCAGCCAAGATGTGCTTGTCGTA
GGCCCAAATGTCACGACGAGATCGGATTTCCGAATTTTTTCCAGCGATGGAAATGTGACGATGAGAAG
CTTCCTCAATAATGAAACGTTCTTCGATACTTGCGCGAATCTCATAGAGAGG
ATGATCAACACGGTACCCAATGGAGTGACTCTGACGGATCCTATTGACCCCTTACAATACCTCGTCTATCAACCGTTGTTATCATATCAAAATGGGACCTTGATCATGACCACTGCGTTA
CGA
CTTATAAATGCAAGTGACAACCCCAGCCGGACGATAACTCTCTTTTGGGCCGATCGACGAGGGTCATTCTGCCCTTCAACTGGATGCTCTGTACAAACGACTGGTACACAATTCCTT
ACTACGAACATATATCTCTCAGCCAAAGGCTATAACGCGACCAAATACCTTTTCAACGCTACTATCAACGCTTCGACTTCGATATCCAAGTTCTGGTTCGAAATAAACGAAAATGACGGG
TCTCAACCAGTCGCAGTGGACAACGGAGGCTCTGGGTTTTCTATCGCACAAGATTCCGTATTCATCGATAGCTTGCGTAGCAAGACTGTGTTTACTTCGACTGATATCTTCCTAAAAGTC
GTTGTGGCG
GTTCGTGGCGATTCCAACGCGACGAGCGTAGCAATGACTACATTCGATCCGACCACACCGCTCTTCAATCCTACGCCTCCTTTCCTCCCCAACATAACTGTCATGAACCTA
GAACTTGACGAAAGCAACCCTCCGGAGGGTGGATTTACTTTTTTCTCTGGAGCGGCTACCCAGCAGGTAACAACTGTTAACTACACAGGAAGTGTCGTGGGAGGAACGACTTTTAACGTG
AATGACTTCGATCTCAAATCTGTTACCTTTGATTTGGAGTTCGAGTAA

Retrieve as FASTA