Entry information : GluxAPx-CcP03
Entry ID 10645
Creation 2012-03-02 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: GluxAPx-CcP03
Name GluxAPx-CcP03
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP003]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Gymnopus
Organism Gymnopus luxurians    [TaxId: 206324 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GluxAPx-CcP03
start..stop
S start..stop
GluxAPx-CcP08 571 0 17..461 12..428
GluxAPx-CcP07 553 0 18..454 11..422
GluxAPx-CcP06 546 0 19..459 14..426
GluxAPx-CcP[P]09 533 0 12..461 7..428
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1020354..1020578 225 N° 2 1020206..1020292 87 N° 3 1020071..1020143 73 N° 4 1019694..1020003 310
N° 5 1019522..1019635 114 N° 6 1019292..1019469 178 N° 7 1018830..1019240 411  
complement(join(1018830..1019240,1019292..1019469,1019522..1019635,1019694..1020 003,1020071..1020143,1020206..1020292,1020354..1020578))


exon

Literature and cross-references GluxAPx-CcP03
DNA ref. JGI genome:   scaffold_10 (1020578..1018830)
Cluster/Prediction ref. JGI gene:   39276
Protein sequence: GluxAPx-CcP03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   466
PWM (Da):   %s   50679.35 Transmb domain:   %s   i13-35o
PI (pH):   %s   4.8
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARPAPNLHCLPFQIIIVIACIFAGFVNGFATFQWPNTLLSYADFQLYEAARFSSLAEECAPRQSTTVAAQWLRIAYHDMSTHNKFDGTGGLDASIQFELERTQNVGIGMAQSLADFATLLVTTPFFGTADLIALGAVFGVASCGGPIIPYRAGRVDATRAGPPTVPLPQQDLASHIESFRRQGFSQTEMIALVACGHTLGGVRQVDFPTIVTNPTTIMANFDTTPTFDNTVVSQYLQNTTQNVLVVGPNITTRSDFRIFSSDGNATMQSLLSPTTFDDTCANLIERLINTVPNGVTLSEPIAEPFDYLVTNPLFSYRSGLFSMTTALVLNLSNNPRRTVTMFWLDRQGSSCPPVGCSVRSSSNQTNILNSFGHLISSVTSSNRFFFNATINATTSISKFWFEISENDGSEPVLVDNNGPGYVIEQDEVFVDVQRSEIVTVIQPQSLPSFFTFKKLVLAVSTSA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACGTCCTGCGCCGAATCTTCACTGCTTGCCATTCCAAATAATCATAGTGATAGCCTGTATTTTTGCTGGCTTCGTAAACGGTTTTGCCACATTCCAATGGCCCAACACGTTGCTG
AGCTATGCAGATTTTCAGCTTTACGAGGCCGCTAGATTCAGCTCCTTAGCAGAAGAATGCGCGCCAAGGCAAAGTACCACTGTAGCCGCACAATGGCTTCGTATT
GTGAGCTTTCGACCC
AATGAATGAATGAGCACGTACGCTAAACCGTTGCAAATCGACGTAGGCTTACCATGACATGTCGACTCACAACAAATTCGACGGCACCGGTGGACTCGATGCTTCCATCCAGTTCGAACT
GGAAAGGACTCAG
GTATGAGATTGTCATAGCAGCCCTGCTTATATTGCGGCTGACACCTTATCGACTTGGAACAGAATGTCGGGATCGGAATGGCTCAGTCTTTGGCTGACTTTGCCACC
CTTCTGGTAACCACTCCGTTTTTTGGAA
GTACGTTCACAGAGTTTCCCATGAAACTGGTAGCTAATGCCTCGCGTGGATTCGCTGCTATGTATAGCGGCAGACCTGATCGCTTTAGGCGC
AGTGTTCGGCGTAGCATCATGTGGAGGTCCAATAATCCCCTATCGCGCTGGTCGGGTCGATGCTACCAGAGCTGGCCCGCCTACCGTCCCGCTACCACAACAGGATCTTGCATCACATAT
TGAGTCCTTCCGCCGTCAAGGATTCAGTCAAACTGAGATGATAGCGCTGGTTGCATGCGGGCATACCCTCGGTGGAGTCAGACAAGTAGATTTTCCAACAATAGTAACAAATCCTACCAC
GATTATGGCCAACTTCGACACCACACCGACTTTTGATAACACAGT
GTACGAGAGGTCCATTTCTTGAGCTTTCCTCCTTCTTATGGCAAGACTTTTTGATCAGGGTTTCGCAATATCTCC
AAAACACCACCCAAAATGTCCTCGTCGTGGGCCCCAATATAACGACAAGATCGGATTTCCGAATCTTTTCAAGTGATGGCAATGCAACTATGCAAAG
GTGCTCTTTCATCCATTGGACAG
AATATATTTTTCCTTAATGTATACGACAGTCTACTATCACCCACGACGTTCGACGACACATGCGCAAACCTGATCGAAAGGCTGATCAATACCGTTCCAAACGGCGTAACTCTTTCTGAG
CCCATAGCTGAACCGTTCGACTACCTCGTCACCAATCCTTTATTCTCTTATCGGAGTGGTTTGTTCAGTATGACGACCGCTCTCCGA
GTAAGTAGGATCCCTTTCCCAATATGATCAGTA
CAGAGCTTCGCATCGTAGGTTCTCAATCTCAGCAATAATCCACGTCGAACAGTGACCATGTTCTGGCTTGATCGACAAGGTTCTTCCTGTCCACCCGTTGGATGCTCCGTTCGGTCTTCA
AGCAACCAAACCAACATTCTAAATAGCTTCGGACACCTTATTTCTAGTGTCACTTCCTCCAACAGGTTTTTCTTCAATGCGACTATCAATGCGACTACGTCTATCTCCAAATTCTGGTTC
GAAATTAGCGAAAATGACGGATCTGAACCAGTATTAGTAGACAACAACGGCCCGGGATATGTAATTGAACAAGATGAAGTGTTTGTGGACGTCCAACGAAGCGAAATTGTCACTGTCATT
CAACCTCAAAGTTTACCAAGTTTCTTCACGTTCAAAAAGCTCGTATTGGCCGTGAGTACTTCTGCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACGTCCTGCGCCGAATCTTCACTGCTTGCCATTCCAAATAATCATAGTGATAGCCTGTATTTTTGCTGGCTTCGTAAACGGTTTTGCCACATTCCAATGGCCCAACACGTTGCTG
AGCTATGCAGATTTTCAGCTTTACGAGGCCGCTAGATTCAGCTCCTTAGCAGAAGAATGCGCGCCAAGGCAAAGTACCACTGTAGCCGCACAATGGCTTCGTATT
GCTTACCATGACATG
TCGACTCACAACAAATTCGACGGCACCGGTGGACTCGATGCTTCCATCCAGTTCGAACTGGAAAGGACTCAG
AATGTCGGGATCGGAATGGCTCAGTCTTTGGCTGACTTTGCCACCCTT
CTGGTAACCACTCCGTTTTTTGGAA
CGGCAGACCTGATCGCTTTAGGCGCAGTGTTCGGCGTAGCATCATGTGGAGGTCCAATAATCCCCTATCGCGCTGGTCGGGTCGATGCTACCAGA
GCTGGCCCGCCTACCGTCCCGCTACCACAACAGGATCTTGCATCACATATTGAGTCCTTCCGCCGTCAAGGATTCAGTCAAACTGAGATGATAGCGCTGGTTGCATGCGGGCATACCCTC
GGTGGAGTCAGACAAGTAGATTTTCCAACAATAGTAACAAATCCTACCACGATTATGGCCAACTTCGACACCACACCGACTTTTGATAACACAGT
GGTTTCGCAATATCTCCAAAACACC
ACCCAAAATGTCCTCGTCGTGGGCCCCAATATAACGACAAGATCGGATTTCCGAATCTTTTCAAGTGATGGCAATGCAACTATGCAAAG
TCTACTATCACCCACGACGTTCGACGACACA
TGCGCAAACCTGATCGAAAGGCTGATCAATACCGTTCCAAACGGCGTAACTCTTTCTGAGCCCATAGCTGAACCGTTCGACTACCTCGTCACCAATCCTTTATTCTCTTATCGGAGTGGT
TTGTTCAGTATGACGACCGCTCTCCGA
GTTCTCAATCTCAGCAATAATCCACGTCGAACAGTGACCATGTTCTGGCTTGATCGACAAGGTTCTTCCTGTCCACCCGTTGGATGCTCCGTT
CGGTCTTCAAGCAACCAAACCAACATTCTAAATAGCTTCGGACACCTTATTTCTAGTGTCACTTCCTCCAACAGGTTTTTCTTCAATGCGACTATCAATGCGACTACGTCTATCTCCAAA
TTCTGGTTCGAAATTAGCGAAAATGACGGATCTGAACCAGTATTAGTAGACAACAACGGCCCGGGATATGTAATTGAACAAGATGAAGTGTTTGTGGACGTCCAACGAAGCGAAATTGTC
ACTGTCATTCAACCTCAAAGTTTACCAAGTTTCTTCACGTTCAAAAAGCTCGTATTGGCCGTGAGTACTTCTGCGTAG

Retrieve as FASTA