Entry information : GluxAPx-CcP06
Entry ID 10648
Creation 2012-03-02 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: GluxAPx-CcP06
Name GluxAPx-CcP06
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP003]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Gymnopus
Organism Gymnopus luxurians    [TaxId: 206324 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GluxAPx-CcP06
start..stop
S start..stop
GluxAPx-CcP07 861 0 4..514 2..512
GluxAPx-CcP08 847 0 1..511 1..512
GluxAPx-CcP[P]09 845 0 1..514 1..516
GluxAPx-CcP05 654 0 74..512 1..458
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 377718..377924 207 N° 2 377980..378066 87 N° 3 378129..378201 73 N° 4 378256..378565 310
N° 5 378627..378740 114 N° 6 378808..378925 118 N° 7 379045..379410 366 N° 8 379470..379742 273
join(377718..377924,377980..378066,378129..378201,378256..378565,378627..378740, 378808..378925,379045..379410,379470..379742)


exon

Literature and cross-references GluxAPx-CcP06
DNA ref. JGI genome:   scaffold_46 (377718..379742)
Cluster/Prediction ref. JGI gene:   229970
Protein sequence: GluxAPx-CcP06
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   516 (491)
PWM (Da):   %s   55702.25 (52930.7)  
PI (pH):   %s   4.06 (3.99) Peptide Signal:   %s   cut: 25 range:25-515
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKPLPQFLFAQAFIVCALGRLVQSFSTFQWPNPLLNYADRQLYEGPVDILAEGCPPRNDSTIPAQWLRIAYHDMSTHNVDDGTGGLDASIQYELDRSQNVGEGMLASLNDFNGFQIISPFFGMADVIALGAIMAVAGCGGPFIPFSAGRVDATEAGPPTVPEPQQDLASHAESFRRQGFTPTEMIALVACGHTLGGVRQVDFPLVVTDSATVLQTFDTTPAFDTAVVSEYLQNTTQNPLVVGPNVTTRSDFRIFSSDGNATMQSLLSPANFNQTCSSLFERMLNTVPSNVNLTDPITEPFEYLVMNDNPSRTVTLLWADRQGLFCPPSGCSQPSNSTENVFFTIIGQMQEVTATRYPFNATINATSSISKFWFEINENDGSEPITVDNGGAGFVIDQDSVFVDVVRTERIVAHSGPVSEEFMKLVVRENSASSGASVASFTPSLNANPPFTPTINTTDLQLDASNPPDGKFAFFTANISFSATFLDLTISSANSTITQKNFDLTAVNLPFIFTSL

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACCGCTTCCCCAATTTTTGTTTGCTCAAGCCTTCATAGTCTGTGCTCTCGGTCGCCTCGTCCAAAGTTTTTCGACATTCCAATGGCCCAATCCTTTGTTAAATTATGCGGATAGA
CAGCTTTATGAAGGCCCAGTGGACATTCTTGCGGAAGGCTGCCCTCCACGGAATGACAGTACTATACCGGCGCAATGGCTTCGTATC
GTGAGTTATCATTTGCATAATTAGCATGAAGTG
GTTTTGGAAACTCTCTGGGCAGGCTTATCATGACATGTCTACTCATAACGTCGATGATGGCACTGGAGGCCTCGATGCTTCGATTCAATACGAACTTGACAGATCACAGGTATCTACATT
CTTTTTATTCATTCTTGCCTCAGCAGTAGGTCCTTCATGATAACTTGATAGAATGTCGGTGAAGGAATGCTTGCGTCGCTAAATGATTTCAATGGTTTCCAAATAATATCTCCATTTTTT
GGAA
GTATGTGAGACTTAACTATCAACAAAGAATGAATCTGCTAACCTCCGTCCGCAGTGGCAGATGTGATTGCCTTAGGGGCCATTATGGCCGTTGCTGGATGCGGAGGCCCCTTCATT
CCTTTCAGTGCTGGTCGTGTTGACGCTACAGAGGCCGGACCACCGACTGTCCCAGAGCCACAGCAAGATCTTGCTAGCCATGCGGAGTCATTCCGTCGTCAAGGATTTACCCCCACTGAA
ATGATAGCTCTCGTTGCGTGTGGACATACTCTGGGTGGAGTCAGACAAGTGGACTTTCCTTTGGTTGTTACAGATAGTGCGACAGTTTTGCAAACTTTTGATACGACGCCTGCCTTTGAC
ACCGCCGT
GTAAGTGAAATCTTGGCGTATCGATAATTGTCCACCTGATGAAACTTCACTTTCTTTTTAGTGTCTCCGAATATCTGCAAAACACTACCCAAAATCCACTTGTTGTAGGCCC
GAATGTCACAACCAGGTCAGATTTCCGTATTTTTTCTAGCGACGGTAATGCCACAATGCAAAG
GTATGGCTCGTGCCTCTTCAAGTAACTTCATCCCCATTAACTGAATTGTCTCTTCAA
TTGGCTCCAGTCTGCTATCTCCGGCCAACTTCAATCAAACATGTTCCAGCCTTTTCGAGCGAATGCTCAACACCGTCCCCAGTAATGTGAACCTCACAGATCCTATCACTGAACCATTCG
AGTATCTT
GTCACTGACCCTCAGTTTACTTACCGTGATGGGTCATTGTTCATGGCCACTGCCATACGCGTGCGTACCCTCAAAATCATGATCAGTATATATTCAAATTTGCGTAACTCTT
TTGGTAGGTTATGAACGACAATCCAAGCCGCACGGTGACTTTGCTGTGGGCTGATCGACAGGGATTGTTTTGCCCTCCCAGTGGCTGCTCTCAGCCGTCAAACAGTACTGAAAATGTGTT
TTTCACTATAATCGGCCAAATGCAGGAGGTTACAGCTACAAGATACCCGTTCAATGCGACTATAAACGCGACGTCTTCAATTTCCAAGTTCTGGTTCGAGATCAATGAGAATGATGGTTC
CGAGCCGATTACTGTTGATAATGGAGGGGCTGGATTTGTGATTGATCAAGATTCGGTGTTTGTTGATGTTGTTCGAACTGAAAGAATTGTGGCACATTCAGGACCGGTATCGGAGGAATT
TATGAAACTCGTA
GTGGCGGTATGCATGCATGCTCAGATATCTGCTTTGACATTTGCTTATTATTTTTGTAGGTCCGTGAAAACAGTGCTTCATCTGGCGCATCCGTAGCTTCATTCACC
CCCAGCCTCAATGCAAATCCTCCGTTCACGCCGACTATCAATACAACCGATCTCCAGCTTGATGCAAGCAACCCTCCTGATGGAAAATTTGCATTCTTCACCGCGAACATTAGCTTCAGC
GCGACGTTTTTGGATCTTACAATATCTTCTGCGAACAGTACTATTACACAGAAGAACTTCGATTTGACTGCGGTCAATCTTCCTTTCATTTTCACGTCATTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACCGCTTCCCCAATTTTTGTTTGCTCAAGCCTTCATAGTCTGTGCTCTCGGTCGCCTCGTCCAAAGTTTTTCGACATTCCAATGGCCCAATCCTTTGTTAAATTATGCGGATAGA
CAGCTTTATGAAGGCCCAGTGGACATTCTTGCGGAAGGCTGCCCTCCACGGAATGACAGTACTATACCGGCGCAATGGCTTCGTATC
GCTTATCATGACATGTCTACTCATAACGTCGAT
GATGGCACTGGAGGCCTCGATGCTTCGATTCAATACGAACTTGACAGATCACAG
AATGTCGGTGAAGGAATGCTTGCGTCGCTAAATGATTTCAATGGTTTCCAAATAATATCTCCATTT
TTTGGAA
TGGCAGATGTGATTGCCTTAGGGGCCATTATGGCCGTTGCTGGATGCGGAGGCCCCTTCATTCCTTTCAGTGCTGGTCGTGTTGACGCTACAGAGGCCGGACCACCGACTGTC
CCAGAGCCACAGCAAGATCTTGCTAGCCATGCGGAGTCATTCCGTCGTCAAGGATTTACCCCCACTGAAATGATAGCTCTCGTTGCGTGTGGACATACTCTGGGTGGAGTCAGACAAGTG
GACTTTCCTTTGGTTGTTACAGATAGTGCGACAGTTTTGCAAACTTTTGATACGACGCCTGCCTTTGACACCGCCGT
TGTCTCCGAATATCTGCAAAACACTACCCAAAATCCACTTGTT
GTAGGCCCGAATGTCACAACCAGGTCAGATTTCCGTATTTTTTCTAGCGACGGTAATGCCACAATGCAAAG
TCTGCTATCTCCGGCCAACTTCAATCAAACATGTTCCAGCCTTTTCGAG
CGAATGCTCAACACCGTCCCCAGTAATGTGAACCTCACAGATCCTATCACTGAACCATTCGAGTATCTT
GTTATGAACGACAATCCAAGCCGCACGGTGACTTTGCTGTGGGCTGATCGA
CAGGGATTGTTTTGCCCTCCCAGTGGCTGCTCTCAGCCGTCAAACAGTACTGAAAATGTGTTTTTCACTATAATCGGCCAAATGCAGGAGGTTACAGCTACAAGATACCCGTTCAATGCG
ACTATAAACGCGACGTCTTCAATTTCCAAGTTCTGGTTCGAGATCAATGAGAATGATGGTTCCGAGCCGATTACTGTTGATAATGGAGGGGCTGGATTTGTGATTGATCAAGATTCGGTG
TTTGTTGATGTTGTTCGAACTGAAAGAATTGTGGCACATTCAGGACCGGTATCGGAGGAATTTATGAAACTCGTA
GTCCGTGAAAACAGTGCTTCATCTGGCGCATCCGTAGCTTCATTC
ACCCCCAGCCTCAATGCAAATCCTCCGTTCACGCCGACTATCAATACAACCGATCTCCAGCTTGATGCAAGCAACCCTCCTGATGGAAAATTTGCATTCTTCACCGCGAACATTAGCTTC
AGCGCGACGTTTTTGGATCTTACAATATCTTCTGCGAACAGTACTATTACACAGAAGAACTTCGATTTGACTGCGGTCAATCTTCCTTTCATTTTCACGTCATTGTAA

Retrieve as FASTA