Entry information : GluxAPx-CcP07
Entry ID 10649
Creation 2012-03-02 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: GluxAPx-CcP07
Name GluxAPx-CcP07
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP003]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Gymnopus
Organism Gymnopus luxurians    [TaxId: 206324 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GluxAPx-CcP07
start..stop
S start..stop
GluxAPx-CcP[P]09 886 0 2..512 4..516
GluxAPx-CcP08 878 0 1..512 3..515
GluxAPx-CcP06 858 0 2..512 4..514
GluxAPx-CcP05 670 0 72..511 1..459
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 361691..361891 201 N° 2 361951..362037 87 N° 3 362090..362162 73 N° 4 362217..362526 310
N° 5 362588..362701 114 N° 6 362776..362893 118 N° 7 363011..363376 366 N° 8 363444..363713 270
join(361691..361891,361951..362037,362090..362162,362217..362526,362588..362701, 362776..362893,363011..363376,363444..363713)


exon

Literature and cross-references GluxAPx-CcP07
DNA ref. JGI genome:   scaffold_46 (361691..363713)
Cluster/Prediction ref. JGI gene:   229967
Protein sequence: GluxAPx-CcP07
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   513 (490)
PWM (Da):   %s   55286.2 (52842.9)  
PI (pH):   %s   4.03 (4.02) Peptide Signal:   %s   cut: 23 range:23-512
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLSQPLFAQALIVCALSDLVRSLSTFQWPNPLLSYADRQLYEGPLQGFAKGCPPRDNTTIPAQWLRIAYHDMSTHNVDDGTGGLDASIQYELDRSQNVGEGMLTSLTDFNGFRIMSPFFALADVIALGAILAVAGCGGPFIPFSVGRVDATEAGPPTVPEPQQDLASHIESFRRQGFTPTEMIALVACGHTLGGVRQVDFPLIVTDSSTVLQTFDTTPAFDTAVVSEYLQNTTQNPLVIGPNVTTRSDFRIFSSDGNATMQSLLSPINFNQTCSSLFERMLNTVPSNVNLTDPITEPFDYLVMNDNPSRTVTLLWADRQGSFCPPAGCSQQSNGTQSVLFTIIGQMQGVTALRYPFNATINATSSISKFWFEVNENDGSEPIIVDNGGVGFVIEQDSVFVDIGRSEHISVDTAVEVDEFLTLVVRGDSASASASVTSFTPSLSGTPPFTPTLNKTDLQLDPSNPPEGGYTFFTMNTTLLPTFLDITGTSSSGTVTQKNFDMTVVNFPFIFIS

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTTCTCAGCCCTTGTTCGCTCAAGCCCTCATAGTCTGTGCTCTCAGTGACCTTGTCCGAAGTTTGTCAACATTTCAGTGGCCAAACCCTTTGCTCAGTTACGCGGATAGACAACTT
TATGAAGGTCCATTACAAGGATTTGCAAAAGGCTGCCCTCCACGAGATAATACCACTATACCGGCGCAATGGCTTCGTATT
GTAAGTTATATTTTTGACAATTAGCTTGAAGTGTGCCGG
GTAACATTCCCTCCATTCAGGCTTATCACGACATGTCTACTCACAACGTAGATGATGGCACTGGAGGACTCGATGCTTCGATTCAATACGAGCTCGATAGATCACAGGTATCTTCGTATT
TTTCAATTTGTCCTAGTAATCTTGTTGACAAATTGGTAGAATGTCGGGGAAGGAATGCTTACGTCCCTCACTGATTTCAATGGTTTCCGAATAATGTCTCCCTTTTTTGCATGTATGTAA
GAGGTATTTGTCGACATGGAAAGAATCAGCTTATTCTAACACACAGTGGCCGATGTCATTGCCTTGGGGGCAATTCTGGCTGTTGCTGGATGCGGAGGTCCCTTCATTCCATTCAGTGTC
GGTCGAGTTGATGCTACAGAGGCCGGACCACCGACCGTCCCAGAGCCACAGCAGGATCTGGCTAGCCACATAGAGTCATTCCGTCGTCAGGGATTCACCCCCACCGAAATGATAGCTCTT
GTTGCGTGTGGACATACATTGGGTGGAGTCAGACAAGTGGATTTCCCATTGATTGTTACAGATAGTTCAACAGTTCTGCAAACTTTTGATACGACGCCTGCCTTTGACACCGCTGT
GTAG
GCAAAATCTTGCTGTTTCTGATGGTTGTCCGGCTAATGAAAACTTGATTCTTTATAGTGTCTCCGAATATCTTCAAAACACCACTCAGAATCCGCTTGTTATAGGCCCAAACGTCACCAC
CAGGTCGGATTTCCGTATTTTTTCAAGTGACGGAAATGCAACAATGCAAAG
GTACGATTTGTGCCTCTTCTGACTCCTGAGTTCATTCCCTTCGACTAAAACTCTATTTGTTCGATATGT
TTAAGTCTGTTATCTCCCATCAACTTCAACCAGACATGTTCGAGCCTCTTCGAGCGAATGCTCAACACTGTTCCTAGTAATGTGAACCTTACCGACCCTATCACTGAACCGTTCGACTAT
CTC
GTCACCGACCCTATGTTTTCTTATCGTGATGGCTCATTGTTCATGACTACTGCTCTACGAGTGCGTACCCTTGTTAGGAGTATGCAGAATCAAAGTCAAGTGATCCCAATTTTGTAG

GTCATGAATGACAACCCAAGCCGCACGGTGACTCTGCTGTGGGCCGATCGGCAGGGATCATTTTGCCCTCCCGCCGGTTGCTCCCAGCAATCAAACGGTACCCAAAGTGTCTTGTTCACC
ATAATCGGCCAAATGCAAGGCGTCACCGCGCTCAGATACCCGTTCAATGCAACGATCAACGCAACGTCCTCAATCTCAAAGTTCTGGTTTGAGGTGAACGAGAACGATGGATCTGAGCCA
ATTATTGTCGATAATGGCGGGGTTGGATTTGTGATCGAACAAGATTCGGTATTTGTTGATATCGGTCGAAGTGAACATATTTCAGTAGATACAGCAGTGGAAGTTGATGAATTCCTAACA
CTTGTC
GTGGCGGTATGCATTTCTGTTGTTGGTTTTGGCTCTCTGGTTTCCCGCTTGCTTATGAATTGCATAGGTCCGTGGTGATAGTGCTTCAGCTAGCGCATCTGTAACCTCATTCAC
CCCCAGCTTAAGCGGTACTCCTCCGTTCACGCCGACTCTCAATAAAACTGATCTTCAGCTTGACCCGAGCAACCCTCCCGAAGGAGGTTACACATTCTTCACCATGAATACTACCCTCCT
CCCGACTTTCTTAGATATTACAGGAACTTCCTCGAGCGGTACTGTAACCCAGAAAAATTTCGACATGACTGTAGTCAATTTCCCTTTCATTTTCATTTCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTTCTCAGCCCTTGTTCGCTCAAGCCCTCATAGTCTGTGCTCTCAGTGACCTTGTCCGAAGTTTGTCAACATTTCAGTGGCCAAACCCTTTGCTCAGTTACGCGGATAGACAACTT
TATGAAGGTCCATTACAAGGATTTGCAAAAGGCTGCCCTCCACGAGATAATACCACTATACCGGCGCAATGGCTTCGTATT
GCTTATCACGACATGTCTACTCACAACGTAGATGATGGC
ACTGGAGGACTCGATGCTTCGATTCAATACGAGCTCGATAGATCACAG
AATGTCGGGGAAGGAATGCTTACGTCCCTCACTGATTTCAATGGTTTCCGAATAATGTCTCCCTTTTTTGCA
T
TGGCCGATGTCATTGCCTTGGGGGCAATTCTGGCTGTTGCTGGATGCGGAGGTCCCTTCATTCCATTCAGTGTCGGTCGAGTTGATGCTACAGAGGCCGGACCACCGACCGTCCCAGAG
CCACAGCAGGATCTGGCTAGCCACATAGAGTCATTCCGTCGTCAGGGATTCACCCCCACCGAAATGATAGCTCTTGTTGCGTGTGGACATACATTGGGTGGAGTCAGACAAGTGGATTTC
CCATTGATTGTTACAGATAGTTCAACAGTTCTGCAAACTTTTGATACGACGCCTGCCTTTGACACCGCTGT
TGTCTCCGAATATCTTCAAAACACCACTCAGAATCCGCTTGTTATAGGC
CCAAACGTCACCACCAGGTCGGATTTCCGTATTTTTTCAAGTGACGGAAATGCAACAATGCAAAG
TCTGTTATCTCCCATCAACTTCAACCAGACATGTTCGAGCCTCTTCGAGCGAATG
CTCAACACTGTTCCTAGTAATGTGAACCTTACCGACCCTATCACTGAACCGTTCGACTATCTC
GTCATGAATGACAACCCAAGCCGCACGGTGACTCTGCTGTGGGCCGATCGGCAGGGA
TCATTTTGCCCTCCCGCCGGTTGCTCCCAGCAATCAAACGGTACCCAAAGTGTCTTGTTCACCATAATCGGCCAAATGCAAGGCGTCACCGCGCTCAGATACCCGTTCAATGCAACGATC
AACGCAACGTCCTCAATCTCAAAGTTCTGGTTTGAGGTGAACGAGAACGATGGATCTGAGCCAATTATTGTCGATAATGGCGGGGTTGGATTTGTGATCGAACAAGATTCGGTATTTGTT
GATATCGGTCGAAGTGAACATATTTCAGTAGATACAGCAGTGGAAGTTGATGAATTCCTAACACTTGTC
GTCCGTGGTGATAGTGCTTCAGCTAGCGCATCTGTAACCTCATTCACCCCC
AGCTTAAGCGGTACTCCTCCGTTCACGCCGACTCTCAATAAAACTGATCTTCAGCTTGACCCGAGCAACCCTCCCGAAGGAGGTTACACATTCTTCACCATGAATACTACCCTCCTCCCG
ACTTTCTTAGATATTACAGGAACTTCCTCGAGCGGTACTGTAACCCAGAAAAATTTCGACATGACTGTAGTCAATTTCCCTTTCATTTTCATTTCATAA

Retrieve as FASTA