Entry information : CzmPGHS
Entry ID 10654
Creation 2012-03-02 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: CzmPGHS
Name CzmPGHS
Class H synthase    [Orthogroup: PGHS001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Mycosphaerellaceae Cercospora
Organism Cercospora zeae-maydis    [TaxId: 135779 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CzmPGHS
start..stop
S start..stop
MfiPGHS 987 0 2..610 10..602
RrufPGHS 803 0 1..610 17..624
GzPGHS01 803 0 1..609 31..656
FoPGHS 791 0 1..609 11..637
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 88274..89243 970 N° 2 89291..90162 872  
join(88274..89243,89291..90162)


exon

Literature and cross-references CzmPGHS
DNA ref. JGI genome:   scaffold_1 (88274..90162)
Cluster/Prediction ref. JGI gene:   30662
Protein sequence: CzmPGHS
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   614
PWM (Da):   %s   69472.85  
PI (pH):   %s   6.15
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLVALFKAVNAIVPWHKLPALIGALNLLALRDELREHNLYDTYPTEDFQGTTKSDPIVDTRFVCARNSDGLYNDLDRPKMGCAAMRFGRNVPRKYTAAPSDHDLMTPDPRLVSAKLLQRTEFKPATIVNLLAAAWIQFQVHDWAQHTNSKTKFHHIPLKANDPWPENPMKVAKMVQDEPLDEEDQKFPAYKNENTHWWDASQIYGSTEESTRQLRGKHQDGTLDVDRIEGEHFLPRGHDGIPKTGFRENWWLGLELLHTLFALEHNAICSMLTTKNPSWSGDEIFDVARLINCALMAKIHTIEWTPAILPHPTLDVGMNANWSDLTTDIRRSKLFSSFGKSEAFTGIPESGADSGKAPYCLTEEFVSVYRLHSLIPDDVAFFKLRTGQHTSNIPIQDIAFEQARSVFEGSQNLNFADAFYSFGINFPGAITAHNMPSFLRDLKKPDGEHLDMGCVDILRDRERGVPRYCQFRRLFHMPVPKSFSALTGGNATLATELSQVYDGDIEKVDLLVGCLCEPLPNGFGFSDTAFRVFILMASRRLKSDRFIASDFKDEIYTKEGIEWVQDNDMRDVLVRHYPDLRAPLKDVKNAFAPWGKVGLTEEYRGVQTTAPEK

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGGTCGCTCTGTTCAAGGCCGTGAACGCCATCGTTCCATGGCACAAGCTGCCGGCATTGATCGGCGCGCTCAACTTGCTGGCCTTGCGCGACGAATTGCGAGAGCACAACCTGTAC
GATACGTATCCTACAGAAGACTTCCAGGGCACGACAAAGAGCGATCCGATTGTGGACACCAGGTTCGTCTGTGCGAGGAACAGCGATGGGCTGTACAATGATCTCGACAGACCGAAGATG
GGCTGCGCCGCGATGCGCTTCGGACGGAACGTCCCTCGCAAGTATACCGCTGCTCCAAGCGACCACGACCTCATGACACCAGACCCAAGGCTGGTCAGTGCGAAGCTATTGCAACGTACC
GAATTCAAGCCCGCAACGATCGTCAATTTGCTTGCGGCCGCGTGGATTCAGTTTCAGGTGCATGACTGGGCGCAGCACACCAATTCCAAGACCAAGTTCCACCATATCCCCCTCAAGGCC
AACGATCCTTGGCCAGAGAATCCGATGAAGGTTGCCAAAATGGTGCAGGATGAGCCACTTGACGAAGAAGACCAGAAATTTCCTGCATACAAGAACGAGAATACCCATTGGTGGGATGCC
TCGCAGATCTATGGCTCTACTGAAGAATCTACTCGGCAACTTCGCGGCAAGCATCAAGACGGAACCCTTGACGTGGATCGCATCGAAGGCGAGCATTTCTTGCCTCGAGGACACGATGGC
ATCCCGAAGACTGGCTTTAGGGAAAACTGGTGGCTTGGTCTGGAGCTGCTCCACACACTATTCGCGCTCGAGCACAATGCCATCTGTAGCATGCTGACGACCAAGAATCCCAGTTGGAGT
GGCGACGAGATCTTCGATGTCGCTCGTTTGATCAACTGTGCCCTCATGGCGAAGATCCATACCATCGAGTGGACACCCGCCATCCTTCCTCACCCAACTCTGGACGTTGGCATGAATGCA
AACTGGAGCG
GTCTGCTTGGCCCAACTTGGCAGGTAGCATATTCTACATGCTTCGAGATTTGACCACTGACATTCGCAGGTCCAAACTTTTCTCCAGCTTCGGGAAAAGCGAGGCCTTCA
CCGGCATCCCGGAATCCGGCGCCGACTCAGGCAAGGCTCCCTACTGCCTCACCGAAGAGTTTGTGTCCGTGTATCGCCTCCACAGCCTCATTCCTGACGATGTCGCCTTCTTCAAACTCC
GCACAGGCCAACACACCTCCAACATCCCCATCCAAGACATCGCCTTTGAACAAGCCCGCTCCGTTTTTGAAGGTTCACAAAACCTCAACTTTGCCGATGCCTTCTACTCGTTTGGAATCA
ACTTTCCCGGCGCCATCACTGCACATAATATGCCATCTTTCCTTCGCGATCTCAAAAAGCCCGACGGCGAGCATCTCGATATGGGCTGCGTCGATATTCTTCGCGACCGTGAACGAGGCG
TACCCCGCTACTGCCAATTCCGCAGGCTCTTCCACATGCCCGTACCCAAATCCTTCTCCGCGCTGACTGGCGGCAACGCCACCCTCGCCACAGAACTCTCCCAAGTCTATGATGGCGACA
TCGAAAAAGTCGACCTTCTGGTCGGATGCCTTTGCGAGCCTCTTCCTAATGGTTTTGGGTTCTCCGATACTGCTTTCCGTGTCTTTATCCTCATGGCCAGTCGCCGATTGAAGAGCGATC
GCTTCATTGCCAGCGATTTCAAGGATGAGATTTATACGAAAGAGGGGATCGAATGGGTGCAGGACAACGATATGCGGGACGTGCTTGTGCGGCATTACCCGGATCTGAGGGCGCCGCTGA
AGGACGTAAAGAATGCTTTCGCGCCTTGGGGGAAGGTCGGGCTTACGGAGGAGTATCGAGGTGTGCAGACCACGGCGCCTGAGAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGGTCGCTCTGTTCAAGGCCGTGAACGCCATCGTTCCATGGCACAAGCTGCCGGCATTGATCGGCGCGCTCAACTTGCTGGCCTTGCGCGACGAATTGCGAGAGCACAACCTGTAC
GATACGTATCCTACAGAAGACTTCCAGGGCACGACAAAGAGCGATCCGATTGTGGACACCAGGTTCGTCTGTGCGAGGAACAGCGATGGGCTGTACAATGATCTCGACAGACCGAAGATG
GGCTGCGCCGCGATGCGCTTCGGACGGAACGTCCCTCGCAAGTATACCGCTGCTCCAAGCGACCACGACCTCATGACACCAGACCCAAGGCTGGTCAGTGCGAAGCTATTGCAACGTACC
GAATTCAAGCCCGCAACGATCGTCAATTTGCTTGCGGCCGCGTGGATTCAGTTTCAGGTGCATGACTGGGCGCAGCACACCAATTCCAAGACCAAGTTCCACCATATCCCCCTCAAGGCC
AACGATCCTTGGCCAGAGAATCCGATGAAGGTTGCCAAAATGGTGCAGGATGAGCCACTTGACGAAGAAGACCAGAAATTTCCTGCATACAAGAACGAGAATACCCATTGGTGGGATGCC
TCGCAGATCTATGGCTCTACTGAAGAATCTACTCGGCAACTTCGCGGCAAGCATCAAGACGGAACCCTTGACGTGGATCGCATCGAAGGCGAGCATTTCTTGCCTCGAGGACACGATGGC
ATCCCGAAGACTGGCTTTAGGGAAAACTGGTGGCTTGGTCTGGAGCTGCTCCACACACTATTCGCGCTCGAGCACAATGCCATCTGTAGCATGCTGACGACCAAGAATCCCAGTTGGAGT
GGCGACGAGATCTTCGATGTCGCTCGTTTGATCAACTGTGCCCTCATGGCGAAGATCCATACCATCGAGTGGACACCCGCCATCCTTCCTCACCCAACTCTGGACGTTGGCATGAATGCA
AACTGGAGCG
ATTTGACCACTGACATTCGCAGGTCCAAACTTTTCTCCAGCTTCGGGAAAAGCGAGGCCTTCACCGGCATCCCGGAATCCGGCGCCGACTCAGGCAAGGCTCCCTACTGC
CTCACCGAAGAGTTTGTGTCCGTGTATCGCCTCCACAGCCTCATTCCTGACGATGTCGCCTTCTTCAAACTCCGCACAGGCCAACACACCTCCAACATCCCCATCCAAGACATCGCCTTT
GAACAAGCCCGCTCCGTTTTTGAAGGTTCACAAAACCTCAACTTTGCCGATGCCTTCTACTCGTTTGGAATCAACTTTCCCGGCGCCATCACTGCACATAATATGCCATCTTTCCTTCGC
GATCTCAAAAAGCCCGACGGCGAGCATCTCGATATGGGCTGCGTCGATATTCTTCGCGACCGTGAACGAGGCGTACCCCGCTACTGCCAATTCCGCAGGCTCTTCCACATGCCCGTACCC
AAATCCTTCTCCGCGCTGACTGGCGGCAACGCCACCCTCGCCACAGAACTCTCCCAAGTCTATGATGGCGACATCGAAAAAGTCGACCTTCTGGTCGGATGCCTTTGCGAGCCTCTTCCT
AATGGTTTTGGGTTCTCCGATACTGCTTTCCGTGTCTTTATCCTCATGGCCAGTCGCCGATTGAAGAGCGATCGCTTCATTGCCAGCGATTTCAAGGATGAGATTTATACGAAAGAGGGG
ATCGAATGGGTGCAGGACAACGATATGCGGGACGTGCTTGTGCGGCATTACCCGGATCTGAGGGCGCCGCTGAAGGACGTAAAGAATGCTTTCGCGCCTTGGGGGAAGGTCGGGCTTACG
GAGGAGTATCGAGGTGTGCAGACCACGGCGCCTGAGAAGTAG

Retrieve as FASTA