Entry information : JargLDS02
Entry ID 10656
Creation 2012-03-02 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-11 (Catherine Mathe)
Peroxidase information: JargLDS02
Name JargLDS02
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Jaapiaceae Jaapia
Organism Jaapia argillacea    [TaxId: 202697 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value JargLDS02
start..stop
S start..stop
PplLDS02 1165 0 61..1039 1..994
LbiLDS02 1148 0 30..1040 18..1018
PinvLDS02 1111 0 38..1042 56..1056
SlutLDS02 1085 0 38..1043 56..1069
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 301862..301948 87 N° 2 302004..302045 42 N° 3 302097..302153 57 N° 4 302212..302293 82
N° 5 302346..302557 212 N° 6 302616..302680 65 N° 7 302734..302950 217 N° 8 303013..303249 237
N° 9 303311..303373 63 N° 10 303430..303531 102 N° 11 303586..303665 80 N° 12 303732..303794 63
N° 13 303852..303975 124 N° 14 304033..304048 16 N° 15 304098..304247 150 N° 16 304299..304716 418
N° 17 304769..305003 235 N° 18 305059..305144 86 N° 19 305200..305320 121 N° 20 305377..305545 169
N° 21 305598..305720 123 N° 22 305778..305807 30 N° 23 305863..305939 77 N° 24 305988..306077 90
N° 25 306138..306217 80 N° 26 306275..306365 91 N° 27 306420..306434 15  
join(301862..301948,302004..302045,302097..302153,302212..302293,302346..302557, 302616..302680,302734..302950,303013..303249,303311..303373,303430..303531,30358 6..303665,303732..303794,303852..303975,304033..304048,304098..304247,304299..30 4716,304769..305003,305059..305144,305200..305320,305377..305545,305598..305720, 305778..305807,305863..305939,305988..306077,306138..306217,306275..306365,30642 0..306434)


exon

Literature and cross-references JargLDS02
DNA ref. JGI genome:   scaffold_4 (301862..306434)
Cluster/Prediction ref. JGI gene:   203950
Protein sequence: JargLDS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1044
PWM (Da):   %s   115065.73  
PI (pH):   %s   6.11
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSTPIARKLDDHPEDHGVQKIIRDFREQIRKGFPVPLDLSSLSSVVDAIRHSDAIDDRKMLLEHVLMLMSRLPPGSILTKLQNATVELLYNDLPHPPASYIGPEYAYRTADGSNNNIEAPDMGKAGTPYSRSVQQQKALPSHVLPDPGLVFDVLLKREFVKHPAGLSSLFFSFAALVIHTVFRTSHANVNINETSSYVDLAPLYGNNQESQNKVRVRDGRGLMHPDVFAEDRLLLLPPAVCVLLVLFNRNHYIAKKLLEINERGTYIDPATIPLDDPERNSKLLDQEEDIFQTARLINVAWFGGVVFSDYFSCILGLVRQGSSWSLNPFGEIRNEDRTLFERGRGNACSVEFNCLYRWHATTSAEDEKWVELVFKKLFPTKTYDQVSPMDFKATAKAMEAMEPDCTHWTFGNLQRQADGTFKSEDLANFLFNATEHPAAAFRGRGTPPVMRLNEIMGIEQSRKWGCCSLNDFRFLGLKRYASFREWNPNPEIADAAEKLYGQIDNLELYVGLQAEEAKPLIDGAGLCPGYTISRAILSDAIALTRGDRFFTADFTPFNLTAWGFADCQRDTSGPGFGSMLGRLFLRALPDNCEAESTYTWFPLMTPDSMKGYLQKLEVAGQYSFSRPTGETPLRVVEDYKEIQTVLKSPDGYKVASASLADSLVDGAGFYLASSDPVRSAREQRDVLRALGDTAQATDRIAQFFYQKTKELITTRSYALVGGKTKCIDIVGDVLKAVPLQWVASESGFELKKAKDGPGLYTEAQLYDILGNIYGHLFLDSDPSKAISQKIQVKSQVKELVNHIKENLPASVSGLSLVGLLDQFSQLFKTYPKSAREQFAEGLSELGLSADKIANSILAVMVGATIELSQSLVHVINAYLGDEKTPVSTPSGFGAASTASSAIKGYVFEALRLDPPFAGVYREVAGPSVSAAKTQRLFLDIAKAGNAGLAAQGDGPASYLLGDGCARFLGVELTSKILTSVLRAISEFNNVRRAPGISGQLKRFPANANRAVRWEYLNDSQQASPWPTAMLVFDLA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (26 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCAACTCCCATTGCCCGCAAGCTCGACGACCATCCCGAGGACCATGGTGTGCAGAAGATCATCAGGGACTTCCGTGAACAGGTTTGTCGATGTCGTCAGGAACTTACTGGAGGA
TTCGTGCCTGATCACCAAATAGATCAGGAAGGGCTTCCCCGTTCCCCTCGACTTGTCATCACTGGTGAGTTCACTTGAACGTCTGTGATAAAGTTGACTCAAGCTTCCAATGTAGAGTTC
AGTGGTAGACGCGATCAGGCATAGCGATGCCATTGATGACCGAAAGATGTTG
GTGCGTAATGGATGCATCTTATCCGCCATACCATCTCTGATGTCATCTCCCAACCCAGCTCGAGCACG
TCCTGATGTTGATGTCACGCCTTCCACCGGGGTCTATTCTGACGAAGCTCCAAAACGCTACCGTTGAGCTTT
GTACGTTACTGCTGTGATCCATTACCCTTATTGGGCGCTTATCTTTGG
CCAGTGTATAACGACCTCCCCCATCCTCCCGCTTCCTACATCGGTCCTGAATACGCGTACCGTACCGCTGATGGGTCGAACAACAATATCGAGGCCCCCGACATGGGCAAGGCCGGCACG
CCGTACTCGAGGAGCGTTCAGCAGCAGAAGGCTCTTCCGAGCCACGTTCTACCAGACCCTGGCCTTGTATTCGATGTTTTACTGAAGAGAGAAGGG
GTACGTCTCCAGAAATATCAACCT
TGGAATCTCATCTAATGAAAATGGCATGGTGTAGTTCGTCAAGCACCCGGCTGGCCTTTCCAGTCTCTTCTTCTCGTTCGCTGCCCTCGTCATCCACACGTTAGTACTCTTTCGTTCCTC
TATTCTCTCTGTGCTGAATTGAGCTGCGACAGTGTTTTCCGCACCTCCCACGCCAACGTCAATATCAACGAAACCTCGTCATACGTTGACTTGGCTCCATTATACGGAAACAACCAGGAA
TCCCAGAACAAAGTCCGCGTCCGTGATGGACGTGGTCTCATGCATCCCGATGTCTTCGCAGAGGATAGGCTGTTACTTCTCCCCCCAGCCGTTTGTGTACTCTTGGTGCTCTTCAATCGT
AACCACAAC
GTCAGTCCAATCCCCTTGTGTGGTTTTGGGTGCTGGGGCTATGACTCACCTCAACCGCACAGTACATTGCTAAGAAGCTTCTGGAGATAAATGAACGCGGGACCTACATTG
ATCCTGCCACAATCCCCCTTGACGACCCCGAGAGGAATTCGAAGCTCCTGGATCAGGAAGAAGATATCTTCCAGACTGCTCGTTTAATTAACGTTGCGTGGTTTGGAGGTGTTGTCTTCT
CTGATTACTTCAGCTGTATCTTGGGTTTGGTGAGGCAAGGTAGCAGTTGGAGTTTGAATCCGTTTGGT
GTAAGACTTATTATCTGGCGAACGTTTGATTTTATTCTGATTGTTTGGTGCT
GCCATTTAGGAAATTAGGAACGAAGACCGCACTCTGTTCGAGCGTGGCCGCGGTAACGCTTGCAGCGTCGAGGTATGTATTCCTTGCTTTTAGCTCTTTTTGCGTCATTGACATTGTTTT
CTACAAAGTTCAACTGCTTGTACCGCTGGCATGCAACTACCTCTGCGGAAGATGAGAAGTGGGTTGAATTGGTATTCAAGAAATTGTTCCCCACGAAAACATACGACCAGGTGAATTTCT
ATGTTGTTTCGTGGTAAAGTCGACGAGCTAAGTTGTGTATGAAGGTGTCTCCTATGGACTTCAAAGCCACGGCGAAGGCCATGGAGGCTATGGAGCCTGATTGCACCCACTGGACATTTG
GAAA
GTGAGGAAATGATCACATTCTATCGAGCTTTTCTGAGGTGGTTTGCTAATATGTTCCGACGTATAGCCTTCAGCGTCAAGCAGATGGTACGTTCAAAAGCGAAGATTTGGCGAACT
TCCTCTTCAACGC
GTACGTTTGCAGCGTTATATCGCCCCGATATCCTTATCGATCTTTCTTCTACGCTAGGACCGAGCACCCTGCTGCTGCCTTCAGAGGTCGCGGCACACCCCCAGTTA
TGCGACTGAATGAGATCATGGGCATTGAGCAAAGCAGGAAGTGGGGATGCTGTTCGTTGAATGATTTCAGAAGT
GTCAGTACCTGTCACTTGATTTTCATTTCCACATCTCTGACACCCA
GCGCAATATAGTTCCTTGGCTTGAAGAGTATGTTGAACCATGTCTGCGGCCTGCAAGTTCTCATATTTGATCTTAGGATATGCCAGCTTCCGGGAATGGAACCCCAACCCTGAGATCGCT
GACGCTGCGGAGAAGTTGTATGGTCAAATCGACAACTTGGAACTCTATGTCGGCCTCCAAGCCGAAGAAGCCAAACCACTGATAGACGGTGCTGGACTCTGCCCTG
GTCAGCTTGTCTTT
TTTGCCCTCTCACATACCTCGTCTAACATCCCCTCAGGATATACCATCAGTCGTGCCATCCTAAGCGATGCTATCGCTCTCACTAGAGGCGATCGTTTCTTCACTGCAGACTTTACCCCA
TTCAACCTGACCGCCTGGGGTTTCGCTGATTGTCAGCGTGATACTTCTGGCCCTGGTTTCGGCAGTATGCTTGGTCGTCTCTTCTTGCGAGCCCTCCCGGACAACTGCGAGGCGGAAAGC
ACTTATACTTGGTTCCCCCTGATGACTCCCGATTCTATGAAGGGCTATTTACAGAAGTTGGAGGTTGCAGGCCAGTATTCGTTCTCTCGTCCTACTGGCGAGACCCCTCTTCGTGTTGTT
GAGGATTACAAGGAGATTCAGACCGTGTTGAAGAGTCCTGACGGCTATAAGGTCGCCAGCGCCTCTCTGGCAGACTCGTTGGTTGACGGCGCCGG
GTACGTGGTTGTAACTTTTAGCATC
GTGCCGCTCTCTCATGGCCTCGAACAGTTTCTACCTTGCCTCCTCCGATCCTGTTCGCTCTGCTCGCGAGCAACGTGACGTACTCCGTGCTCTGGGTGATACAGCTCAAGCCACCGACCG
CATTGCTCAGTTCTTCTATCAGAAGACCAAGGAGCTGATTACTACTCGGTCCTACGCCCTTGTTGGAGGCAAGACGAAGTGCATCGATATTGTTGGTGATGTTCTGAAAGCCGTCCCTCT
TCAATGGGTTGCATCCGAGATT
GTGAGTGCATTGCTCGATCGCGACATCTTCCCAACTCAATAGGCCTACTCTTTAGTCTGGGTTTGAGTTGAAGAAGGCGAAGGACGGCCCTGGGCTCT
ACACTGAAGCTCAGCTGTACGACATTCTGGGGAATATCTATGG
GTATGTTAAGGATATTATTTCGTTTCATTTCCATTCAACTCATGCTCGTCTCTAGTCATCTCTTCCTGGACTCTGAT
CCATCCAAGGCTATCTCCCAAAAGATCCAAGTGAAATCCCAAGTCAAGGAGCTCGTGAACCATATCAAGGAGAACCTCCCCGCTAGTGTTAGCGGCCGA
GTGAGCAACTTTACTCTTCCG
TCTCTATTGGAACTCATGTCATCCAACCGACGTAGTTGTCGCTTGTGGGTCTACTGGACCAATTCTCCCAGTTATTCAAGACTTATCCCAAGAGTGCGCGAGAGCAATTCGCGGAGGGTC
TCTCGGAGTTGGGTTTGTCCGCGGACAAGATTGCGAATTCAATTCTGGCCGTGATGGTTGGAGCTACGATCGAACTATCACAAA
GTACGTGCCTCCATCGAGTTTAGTCGGCCATTTGTT
GACGTAGACATGATAGGCTTGGTCCACGTCATCAATGCATATCTCGGTGATGAGAAAACGCCAGTGAGCACGCCATCTGGATTTGGTGCTGCTTCTACAGCATCATCGGCTATCAAGGGG
TATGTTTTCGAAGCACTCC
GTAAGCCCTGCTTCCATCGTCGACGGTCTGAGGCTGATTGACATTGGATGGCGGTAGGACTTGACCCTCCTTTCGCTGGGGTTTATCGTGAGTGATGAGTC
TTAATCGTGATATGTCATAAATAACAATAATGGATGAACAGGTGAAGTCGCGGGGCCGTCCGTAAGTGCTGCGAAGACCCAGCGCTTGTTTTTGGATATCGCAAAAGCTGGCAACGAGGT
TGGTCTTTTTGATGGATGTTTGATCAACAAGCTGACACAGGAGCAGGCCGGCCTTGCTGCGCAAGGTGATGGTCCAGCTAGTTATCTTTTGGGCGATGGTTGTGCACGGTTCTTGGGAGT
GGAGCTCACATCCAAG
GTCGCTATTTTCCTAATCTTGATGTGATGGCAGCCCTCTCATTGTCTTTTCGGTGACCAGATCTTGACGTCCGTCCTTCGGGCTATCTCCGAGTTCAACAATGT
TCGCCGGGCACCAGGCATTTCGGGTCAACTCAAACG
GTGAGTCAGAGGACAGGTAATCATTCACACCGTTCTGATCGGTTTTCTACTCGCTAGTTTCCCGGCCAATGCGAACCGCGCCGT
GCGTTGGGAGTACCTAAACGACAGTCAACAAGCGTCGCCTTGGCCCACCGCGATGCTCGTGCAG
GTGTGTACCATTCTGATGCGTTTCCAAGTTTCTCTCATTCATTTACGCCACCAGTT
TGACCTCGCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCAACTCCCATTGCCCGCAAGCTCGACGACCATCCCGAGGACCATGGTGTGCAGAAGATCATCAGGGACTTCCGTGAACAGATCAGGAAGGGCTTCCCCGTTCCCCTCGACTTG
TCATCACTG
AGTTCAGTGGTAGACGCGATCAGGCATAGCGATGCCATTGATGACCGAAAGATGTTGCTCGAGCACGTCCTGATGTTGATGTCACGCCTTCCACCGGGGTCTATTCTGACG
AAGCTCCAAAACGCTACCGTTGAGCTTT
TGTATAACGACCTCCCCCATCCTCCCGCTTCCTACATCGGTCCTGAATACGCGTACCGTACCGCTGATGGGTCGAACAACAATATCGAGGCC
CCCGACATGGGCAAGGCCGGCACGCCGTACTCGAGGAGCGTTCAGCAGCAGAAGGCTCTTCCGAGCCACGTTCTACCAGACCCTGGCCTTGTATTCGATGTTTTACTGAAGAGAGAAGGG
TTCGTCAAGCACCCGGCTGGCCTTTCCAGTCTCTTCTTCTCGTTCGCTGCCCTCGTCATCCACACTGTTTTCCGCACCTCCCACGCCAACGTCAATATCAACGAAACCTCGTCATACGTT
GACTTGGCTCCATTATACGGAAACAACCAGGAATCCCAGAACAAAGTCCGCGTCCGTGATGGACGTGGTCTCATGCATCCCGATGTCTTCGCAGAGGATAGGCTGTTACTTCTCCCCCCA
GCCGTTTGTGTACTCTTGGTGCTCTTCAATCGTAACCACAAC
TACATTGCTAAGAAGCTTCTGGAGATAAATGAACGCGGGACCTACATTGATCCTGCCACAATCCCCCTTGACGACCCC
GAGAGGAATTCGAAGCTCCTGGATCAGGAAGAAGATATCTTCCAGACTGCTCGTTTAATTAACGTTGCGTGGTTTGGAGGTGTTGTCTTCTCTGATTACTTCAGCTGTATCTTGGGTTTG
GTGAGGCAAGGTAGCAGTTGGAGTTTGAATCCGTTTGGT
GAAATTAGGAACGAAGACCGCACTCTGTTCGAGCGTGGCCGCGGTAACGCTTGCAGCGTCGAGTTCAACTGCTTGTACCGC
TGGCATGCAACTACCTCTGCGGAAGATGAGAAGTGGGTTGAATTGGTATTCAAGAAATTGTTCCCCACGAAAACATACGACCAG
GTGTCTCCTATGGACTTCAAAGCCACGGCGAAGGCC
ATGGAGGCTATGGAGCCTGATTGCACCCACTGGACATTTGGAAA
CCTTCAGCGTCAAGCAGATGGTACGTTCAAAAGCGAAGATTTGGCGAACTTCCTCTTCAACGCGACCGAGCACCCT
GCTGCTGCCTTCAGAGGTCGCGGCACACCCCCAGTTATGCGACTGAATGAGATCATGGGCATTGAGCAAAGCAGGAAGTGGGGATGCTGTTCGTTGAATGATTTCAGAAGT
TTCCTTGGC
TTGAAGA
GATATGCCAGCTTCCGGGAATGGAACCCCAACCCTGAGATCGCTGACGCTGCGGAGAAGTTGTATGGTCAAATCGACAACTTGGAACTCTATGTCGGCCTCCAAGCCGAAGAA
GCCAAACCACTGATAGACGGTGCTGGACTCTGCCCTG
GATATACCATCAGTCGTGCCATCCTAAGCGATGCTATCGCTCTCACTAGAGGCGATCGTTTCTTCACTGCAGACTTTACCCCA
TTCAACCTGACCGCCTGGGGTTTCGCTGATTGTCAGCGTGATACTTCTGGCCCTGGTTTCGGCAGTATGCTTGGTCGTCTCTTCTTGCGAGCCCTCCCGGACAACTGCGAGGCGGAAAGC
ACTTATACTTGGTTCCCCCTGATGACTCCCGATTCTATGAAGGGCTATTTACAGAAGTTGGAGGTTGCAGGCCAGTATTCGTTCTCTCGTCCTACTGGCGAGACCCCTCTTCGTGTTGTT
GAGGATTACAAGGAGATTCAGACCGTGTTGAAGAGTCCTGACGGCTATAAGGTCGCCAGCGCCTCTCTGGCAGACTCGTTGGTTGACGGCGCCGG
TTTCTACCTTGCCTCCTCCGATCCT
GTTCGCTCTGCTCGCGAGCAACGTGACGTACTCCGTGCTCTGGGTGATACAGCTCAAGCCACCGACCGCATTGCTCAGTTCTTCTATCAGAAGACCAAGGAGCTGATTACTACTCGGTCC
TACGCCCTTGTTGGAGGCAAGACGAAGTGCATCGATATTGTTGGTGATGTTCTGAAAGCCGTCCCTCTTCAATGGGTTGCATCCGAGATT
TCTGGGTTTGAGTTGAAGAAGGCGAAGGAC
GGCCCTGGGCTCTACACTGAAGCTCAGCTGTACGACATTCTGGGGAATATCTATGG
TCATCTCTTCCTGGACTCTGATCCATCCAAGGCTATCTCCCAAAAGATCCAAGTGAAATCCCAA
GTCAAGGAGCTCGTGAACCATATCAAGGAGAACCTCCCCGCTAGTGTTAGCGGCCGA
TTGTCGCTTGTGGGTCTACTGGACCAATTCTCCCAGTTATTCAAGACTTATCCCAAGAGTGCG
CGAGAGCAATTCGCGGAGGGTCTCTCGGAGTTGGGTTTGTCCGCGGACAAGATTGCGAATTCAATTCTGGCCGTGATGGTTGGAGCTACGATCGAACTATCACAAA
GCTTGGTCCACGTC
ATCAATGCATATCTCGGTGATGAGAAAACGCCAGTGAGCACGCCATCTGGATTTGGTGCTGCTTCTACAGCATCATCGGCTATCAAGGGGTATGTTTTCGAAGCACTCC
GACTTGACCCT
CCTTTCGCTGGGGTTTATC
GTGAAGTCGCGGGGCCGTCCGTAAGTGCTGCGAAGACCCAGCGCTTGTTTTTGGATATCGCAAAAGCTGGCAACGAGGCCGGCCTTGCTGCGCAAGGTGAT
GGTCCAGCTAGTTATCTTTTGGGCGATGGTTGTGCACGGTTCTTGGGAGTGGAGCTCACATCCAAG
ATCTTGACGTCCGTCCTTCGGGCTATCTCCGAGTTCAACAATGTTCGCCGGGCA
CCAGGCATTTCGGGTCAACTCAAACG
TTTCCCGGCCAATGCGAACCGCGCCGTGCGTTGGGAGTACCTAAACGACAGTCAACAAGCGTCGCCTTGGCCCACCGCGATGCTCGTGCAGTTT
GACCTCGCATAA

Retrieve as FASTA