Entry information : GluxLDS02
Entry ID 10659
Creation 2012-03-02 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-10 (Catherine Mathe)
Peroxidase information: GluxLDS02
Name GluxLDS02
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Gymnopus
Organism Gymnopus luxurians    [TaxId: 206324 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GluxLDS02
start..stop
S start..stop
LbiLDS02 1190 0 8..1055 3..1019
PinvLDS02 1133 0 6..1054 2..1054
SlutLDS02 1108 0 10..1054 10..1066
SbreLDS02 1104 0 10..1054 10..1067
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 560224..560310 87 N° 2 560359..560460 102 N° 3 560519..560575 57 N° 4 560634..560715 82
N° 5 560789..560981 193 N° 6 561036..561054 19 N° 7 561111..561175 65 N° 8 561237..561456 220
N° 9 561512..561653 142 N° 10 561717..561793 77 N° 11 561846..561908 63 N° 12 561961..562142 182
N° 13 562195..562257 63 N° 14 562312..562355 44 N° 15 562413..562508 96 N° 16 562564..562713 150
N° 17 562772..563186 415 N° 18 563243..563462 220 N° 19 563518..563603 86 N° 20 563654..563774 121
N° 21 563831..564101 271 N° 22 564151..564180 30 N° 23 564236..564324 89 N° 24 564382..564467 86
N° 25 564524..564551 28 N° 26 564602..564772 171 N° 27 564832..564849 18  
join(560224..560310,560359..560460,560519..560575,560634..560715,560789..560981, 561036..561054,561111..561175,561237..561456,561512..561653,561717..561793,56184 6..561908,561961..562142,562195..562257,562312..562355,562413..562508,562564..56 2713,562772..563186,563243..563462,563518..563603,563654..563774,563831..564101, 564151..564180,564236..564324,564382..564467,564524..564551,564602..564772,56483 2..564849)


exon

Literature and cross-references GluxLDS02
DNA ref. JGI genome:   scaffold_22 (560224..564849)
Cluster/Prediction ref. JGI gene:   42777
Protein sequence: GluxLDS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1059
PWM (Da):   %s   117870.16  
PI (pH):   %s   6.27
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTQAPSPLDRFPSIFNRRSSVGPGSSAGSGWSTSSGTAQNGSTSATPTFKKANPHLTFEQSGLAATVDFLRHSEAIDDRKLFLEHGLSKLSKMPPGELADKAQDEVIKLLYNDLSHPPATSIGNQYAWRSADGSGNNIADPNLGKAGSTYARSVQQTHPLSPTELPDPGLVFDTLLKRDFKSHPAGLSSLMFSFAALVIHSVFRTSHTDVNINETSSYCDLAPLYGHDQKTQDRVRNKSSGLGLLYPDVFAEDRLLLLPPAVCVILVLFSRNHYIARKIFDINERKKYQDPSKLNDDQRAAQDEELFQTARLCNCGWFGTVIFSDYVSAILGLVREGSNWSLNPFEMRNLDHSEFERGRGNACSVEFNCLYRWHATTSQEDEQWTMKMIEKIFPGKTPDELTPQDFVVGAKQAMAMLPDIEHWTFGNLQRQEDGSFKDEDLANLLKNATEHPAGAFRARGTECMRLHEIMGITQNRLWGVCSMNDFRRYLGLKPFTTFLEWNSDPEIAFAAEKLYGDIEYLELYVGLQAEEAKPVVEGAGLCPGYTISRAILSDAIALTRGDRFFTHDYTPFNLTAWGFADCQRQPDAYGFGSALGRLFLRALPEQFTENSTYAFFPLMTPAAMTVFLKDMNKSDEYDMARPTPKSTGQVTKDYAQVGNIIKDPKFIAHYEERSRQVISGKGFFSAPEDRSEQKQVLNALAGTSEASAELSRFFFVKTQELIKSNSFNLSGSNTRSVNLVRDVLKAVPIHWVADAGIRIKTTASDSGDFTAAELYNMLGEIYSFIFLDVELSKQMVLKEHTKSHIKTLLQYIEYGLGGFNTRLSLSGILSLFSRSKRSEQTIVKHLHNIGYHSSREQANVILAIMVGSVELSVALTNMANLYLDSKYEDNIRQSALGGDLSGSLAGYAREALRLEPPFKGVYRIASSDHNTEGLTIQKNDRVFLDILAAGQDKVFPDPETVNAQRDQSGKTYIVSDGITRCLGEDITVIMTHVLRGIFAIKDIKRAPGNSGVLNRFKDHDRPELNYAYLDEQKFISPWPNSLAVMFTDES*

Retrieve as FASTA  
Remarks Complete sequence from genomic (26 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCCAGGCTCCCAGTCCCCTCGATAGGTTTCCTTCAATATTCAATCGTCGTTCGAGCGTCGGTCCTGGTAGCTCTGCTGGAAGCGTTCGTTCTTCAGCCTAATTCCGACGCTTGTAC
TAACTACCTTTGCAGGGATGGAGTACGTCCAGTGGCACTGCTCAGAACGGTTCCACCAGTGCGACACCAACTTTCAAGAAGGCCAACCCGCATTTGACCTTCGAGCAATCGGGGCTGGTA
CGTGAAGGACCTTCGTGTATGAAGAACGTGTTCAAGACCTCTTCCCTCTTTACAGGCGGCTACGGTGGATTTCTTGAGACACAGCGAGGCAATCGATGACCGAAAACTCTTTGTGAGCCG
AACATTTCCATCCTTCATACTGTCTTGCTGACGTTGGACCCAATTGACAGCTCGAACATGGTCTTTCAAAGCTTTCCAAGATGCCCCCAGGCGAGTTAGCCGACAAAGCGCAGGATGAGG
TCATTAAACTTT
GTGAGTTACTCGCTCCATTTGTGCTTCTATGAATCTTTAATCGTTTCCTCTTCTTCTATTCGCAATTGCGCAGTGTACAATGACCTCTCCCACCCGCCAGCCACTTCA
ATTGGCAACCAGTACGCCTGGCGATCCGCAGATGGGTCTGGTAACAACATTGCCGATCCAAATTTGGGAAAAGCTGGGTCGACTTACGCGCGCAGCGTGCAACAGACTCATCCGCTGTCC
CCAACTGAGCTTCCTGATCCAGGTTTGGTTTTCGATAC
GTAAGTGTATATGTGCTCTAAAGCTCAGAAGGTGTGGTCTAATCAAAGACATAGACTTCTGAAGCGAGATGGCGTACGTTAT
TCCATCAGAACTGGAGGTATTATGATTTAATGTATGTATCTATGCAGTTCAAAAGCCATCCAGCCGGACTTTCGTCCCTAATGTTTTCATTTGCTGCGTTGGTTATCCATAGGTCAGGCT
CATTTCCAATTTTGCTGCTTTGGCCTTCTATTAATAATTTCTATTTTTGGCAGCGTCTTCCGCACGTCCCACACGGATGTTAACATAAACGAAACGTCCTCTTATTGCGATTTGGCCCCT
CTATATGGACACGATCAGAAAACGCAGGACAGAGTCCGCAACAAGTCATCTGGCTTGGGACTTTTGTATCCTGACGTATTTGCAGAAGATAGGCTGTTGCTGCTTCCCCCTGCGGTCTGT
GTAATCTTGGTGTTGTTCAGCAGGAATCATAAC
GTACGAACAAAGTTTCTCCTAACTGTTTTACCCGATGCTCATCAAGAAATCCTAGTACATCGCGAGGAAGATTTTCGATATCAATGA
GCGAAAGAAGTATCAAGATCCCTCGAAGCTCAACGATGATCAACGCGCCGCTCAAGACGAGGAATTGTTCCAGACAGCGCGTTTGTGCAACTGTGGATGGTTCGGTACTG
GTACGTGTTC
TAGCTTTCTACGAGAGGGATCATATGCAGTGCACTAATGTTGCTTCTCGATAGTCATCTTTTCTGACTATGTGTCCGCTATCTTGGGGTTAGTCAGAGAAGGCAGTAACTGGAGTTTGAA
TCCTTTCGGA
GTAGGTTCGATACCCCTCCTTCAAAACTTAGGCTTATCATACGTATCTGCAGGAAATGAGAAACCTTGACCACTCTGAATTCGAGAGAGGACGAGGAAATGCTTGCAGCG
TGGAG
GTGAAGCGACTTTCTATCTACTTCTTTCCACAATCTTACTCGGGATGTTCAGTTCAACTGCCTTTACCGTTGGCATGCCACTACAAGCCAAGAAGACGAACAATGGACGATGAAG
ATGATTGAGAAGATTTTCCCTGGAAAGACTCCAGATGAACTCACCCCGCAAGACTTTGTTGTCGGAGCCAAACAAGCCATGGCAATGTTACCTGACATTGAACATTGGACTTTTGGAAA
G
TGAGTAGATGCTATCTCCCAGTGGAATTTCAGTGCTAATGGTCATGTATAGCTTGCAAAGGCAGGAGGATGGCTCATTCAAAGACGAAGATTTAGCTAATCTGCTAAAGAATGCGTGAGT
GTTTCTCCTGGTTTGCTGCGACAACTAAACTGATTCTCTTGTCGCCAGGACCGAGCATCCCGCAGGAGCCTTCCGCGCCCGAGGTACTCCCGGTGGGTTTCCTATTCTTGAACAATCTAC
CTCCAGCGGTTCCTCATGTTGTTGATCAGAATGTATGCGTCTCCACGAAATCATGGGCATCACTCAAAACCGTTTGTGGGGTGTATGTTCGATGAACGATTTCAGAAGGTATCTCGGTCT
CAAAC
GTAGGTTGATACTCTGAACCTTTTTCTTCATCGGAAATCACTAATCTGGAAACAGCATTCACCACGTTCTTGGAATGGAACTCTGACCCAGAGATTGCGTTCGCCGCTGAAAAGC
TGTATGGAGACATTGAATATCTCGAACTTTACGTTGGGTTGCAAGCCGAAGAGGCTAAACCCGTCGTCGAAGGCGCTGGACTTTGCCCTG
GTGAGCGTTCGATATGTCCGCCTATACAAG
ATTGGAGTTAAACTTTCATTCAATCAAGGTTACACGATCAGTCGTGCCATTCTGAGTGACGCCATCGCCCTCACTCGCGGTGATCGTTTCTTCACTCACGATTACACCCCGTTCAATCTT
ACTGCCTGGGGCTTTGCCGATTGTCAACGTCAGCCCGATGCATATGGATTTGGTAGCGCGCTTGGCCGACTCTTCCTTCGTGCTCTTCCCGAACAATTTACCGAGAATAGTACTTACGCG
TTCTTCCCGCTGATGACGCCGGCAGCCATGACGGTGTTCTTAAAGGATATGAACAAGTCGGACGAGTACGATATGGCGCGGCCTACTCCCAAGTCGACCGGGCAAGTTACAAAGGACTAT
GCTCAGGTGGGAAATATCATCAAGGATCCGAAGTTCATCGCGCATTATGAGGAGAGGTCCAGACAGGTTATCTCTGGCAAAGG
GTATGCAGAGCGATGTTGAGAAGACGGCACCTTCTAA
TTAATAACCTCATTTACAGATTCTTCAGCGCTCCTGAAGACCGCTCAGAGCAAAAACAAGTGCTTAATGCTTTGGCTGGAACATCTGAAGCTTCTGCAGAACTATCGAGATTCTTCTTCG
TAAAGACCCAAGAGCTTATCAAGAGCAACTCATTCAACCTCTCGGGCTCGAACACGCGCTCTGTGAATCTTGTTCGAGATGTCCTCAAGGCTGTACCAATTCACTGGGTTGCTGACATT
G
TAGGTGTTGTGTGTACTGGAGAGGACCGACCCTTACTGTCTCTTGTTTGTGAAGGCTGGAATCCGCATTAAGACTACGGCTTCTGACTCTGGAGATTTCACCGCTGCCGAGTTGTACAAT
ATGCTCGGAGAAATCTACTC
GTAAGTTCTTTATCTATGTTCTGCAATGTGGACTTATGCAACTTCCGCAGGTTCATCTTCCTGGATGTTGAGTTATCGAAGCAGATGGTCTTGAAGGAGC
ACACCAAGTCTCATATCAAGACTCTTTTACAATATATTGAATATGGTCTCGGTGGATTTAATACCAGACGG
GTGCGTCTGTTCAACCTTATGCTACCCGTTTGACACATTTCCTGATACT
CTCATAGTTATCACTCTCCGGCATCCTCTCCCTCTTCTCCAGGTCAAAGAGATCTGAGCAGACTATCGTAAAGCATCTTCACAATATCGGCTACCACTCTTCTCGCGAGCAAGCCAACGT
TATCTTGGCCATCATGGTAGGGAGTGTAGAGCTCTCGGTTGCTCTTACGAACATGGCCAACTTGTATCTGGACTCGAAGTATGAGGACAACATACGTCAGAGCGCTTTGGGTGGGGACCT
GTCGGGTAGCTTGGCAGGCTATGCGAGGGAGGCACTGA
GTAAGTTTAATAGAACTTTTTCTTTCTTTACCACTGACGTTGCCTGTAGGATTGGAGCCTCCGTTCAAGGGTGTTTATCGTG
AGTATTGCTGTCTAGTCTCAATTGTTCGGGCTGACTCTGCGCTTCACCAAAGGTATTGCGTCGAGTGATCACAACACCGAAGGTCTGACCATCCAGAAGAATGATCGCGTATTCCTAGAT
ATTCTCGCTGCTGGCCAAAAT
GTGCGTTCGATAAACCATATCTATTGACTCGCGCTCAATCTTATGCCCGTCTGACAGGACAAAGTTTTCCCCGATCCCGAGACCGTCAATGCTCAAAGA
GATCAGAGCGGCAAAACTTACATTGTCAGCGACGGTATTACTAG
GTAAACTTGTCTCTATGCAATAAGCGACGCAGTGCGATTTAACTTTCTTCCAACAGGTGCCTCGGAGAAGACATCA
CTGTCCAG
GTGAGTTGACATTGATGTTTGTCTCAAACCTCATTAACCCTTTTCCACAGATAATGACCCATGTCCTGCGTGGCATTTTCGCTATCAAAGACATCAAGCGCGCGCCTGGAAA
TTCCGGCGTTCTGAATAGGTTCAAGGACCATGACCGTCCAGAGTTGAACTATGCCTACCTTGATGAGCAGAAATTCATCTCGCCGTGGCCGAATTCATTAGCAGTGATG
GTATGTGATTC
TGGTCTCGTCGTCCATCCTCTGCCTTCTGACTAAGATGCAAATTTAAGTTCACCGATGAATCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCCAGGCTCCCAGTCCCCTCGATAGGTTTCCTTCAATATTCAATCGTCGTTCGAGCGTCGGTCCTGGTAGCTCTGCTGGAAGCGGATGGAGTACGTCCAGTGGCACTGCTCAGAAC
GGTTCCACCAGTGCGACACCAACTTTCAAGAAGGCCAACCCGCATTTGACCTTCGAGCAATCGGGGCTG
GCGGCTACGGTGGATTTCTTGAGACACAGCGAGGCAATCGATGACCGAAAA
CTCTTT
CTCGAACATGGTCTTTCAAAGCTTTCCAAGATGCCCCCAGGCGAGTTAGCCGACAAAGCGCAGGATGAGGTCATTAAACTTTTGTACAATGACCTCTCCCACCCGCCAGCCACT
TCAATTGGCAACCAGTACGCCTGGCGATCCGCAGATGGGTCTGGTAACAACATTGCCGATCCAAATTTGGGAAAAGCTGGGTCGACTTACGCGCGCAGCGTGCAACAGACTCATCCGCTG
TCCCCAACTGAGCTTCCTGATCCAGGTTTGGTTTTCGATAC
ACTTCTGAAGCGAGATGGCTTCAAAAGCCATCCAGCCGGACTTTCGTCCCTAATGTTTTCATTTGCTGCGTTGGTTATC
CATAG
CGTCTTCCGCACGTCCCACACGGATGTTAACATAAACGAAACGTCCTCTTATTGCGATTTGGCCCCTCTATATGGACACGATCAGAAAACGCAGGACAGAGTCCGCAACAAGTCA
TCTGGCTTGGGACTTTTGTATCCTGACGTATTTGCAGAAGATAGGCTGTTGCTGCTTCCCCCTGCGGTCTGTGTAATCTTGGTGTTGTTCAGCAGGAATCATAAC
TACATCGCGAGGAAG
ATTTTCGATATCAATGAGCGAAAGAAGTATCAAGATCCCTCGAAGCTCAACGATGATCAACGCGCCGCTCAAGACGAGGAATTGTTCCAGACAGCGCGTTTGTGCAACTGTGGATGGTTC
GGTACTG
TCATCTTTTCTGACTATGTGTCCGCTATCTTGGGGTTAGTCAGAGAAGGCAGTAACTGGAGTTTGAATCCTTTCGGAGAAATGAGAAACCTTGACCACTCTGAATTCGAGAGA
GGACGAGGAAATGCTTGCAGCGTGGAG
TTCAACTGCCTTTACCGTTGGCATGCCACTACAAGCCAAGAAGACGAACAATGGACGATGAAGATGATTGAGAAGATTTTCCCTGGAAAGACT
CCAGATGAACTCACCCCGCAAGACTTTGTTGTCGGAGCCAAACAAGCCATGGCAATGTTACCTGACATTGAACATTGGACTTTTGGAAA
CTTGCAAAGGCAGGAGGATGGCTCATTCAAA
GACGAAGATTTAGCTAATCTGCTAAAGAATGC
GACCGAGCATCCCGCAGGAGCCTTCCGCGCCCGAGGTACTCCCGAATGTATGCGTCTCCACGAAATCATGGGCATCACTCAAAACCGT
TTGTGGGGTGTATGTTCGATGAACGATTTCAGAAGGTATCTCGGTCTCAAAC
CATTCACCACGTTCTTGGAATGGAACTCTGACCCAGAGATTGCGTTCGCCGCTGAAAAGCTGTATGGA
GACATTGAATATCTCGAACTTTACGTTGGGTTGCAAGCCGAAGAGGCTAAACCCGTCGTCGAAGGCGCTGGACTTTGCCCTG
GTTACACGATCAGTCGTGCCATTCTGAGTGACGCCATC
GCCCTCACTCGCGGTGATCGTTTCTTCACTCACGATTACACCCCGTTCAATCTTACTGCCTGGGGCTTTGCCGATTGTCAACGTCAGCCCGATGCATATGGATTTGGTAGCGCGCTTGGC
CGACTCTTCCTTCGTGCTCTTCCCGAACAATTTACCGAGAATAGTACTTACGCGTTCTTCCCGCTGATGACGCCGGCAGCCATGACGGTGTTCTTAAAGGATATGAACAAGTCGGACGAG
TACGATATGGCGCGGCCTACTCCCAAGTCGACCGGGCAAGTTACAAAGGACTATGCTCAGGTGGGAAATATCATCAAGGATCCGAAGTTCATCGCGCATTATGAGGAGAGGTCCAGACAG
GTTATCTCTGGCAAAGG
ATTCTTCAGCGCTCCTGAAGACCGCTCAGAGCAAAAACAAGTGCTTAATGCTTTGGCTGGAACATCTGAAGCTTCTGCAGAACTATCGAGATTCTTCTTCGTA
AAGACCCAAGAGCTTATCAAGAGCAACTCATTCAACCTCTCGGGCTCGAACACGCGCTCTGTGAATCTTGTTCGAGATGTCCTCAAGGCTGTACCAATTCACTGGGTTGCTGACATT
GCT
GGAATCCGCATTAAGACTACGGCTTCTGACTCTGGAGATTTCACCGCTGCCGAGTTGTACAATATGCTCGGAGAAATCTACTC
GTTCATCTTCCTGGATGTTGAGTTATCGAAGCAGATG
GTCTTGAAGGAGCACACCAAGTCTCATATCAAGACTCTTTTACAATATATTGAATATGGTCTCGGTGGATTTAATACCAGACGG
TTATCACTCTCCGGCATCCTCTCCCTCTTCTCCAGG
TCAAAGAGATCTGAGCAGACTATCGTAAAGCATCTTCACAATATCGGCTACCACTCTTCTCGCGAGCAAGCCAACGTTATCTTGGCCATCATGGTAGGGAGTGTAGAGCTCTCGGTTGCT
CTTACGAACATGGCCAACTTGTATCTGGACTCGAAGTATGAGGACAACATACGTCAGAGCGCTTTGGGTGGGGACCTGTCGGGTAGCTTGGCAGGCTATGCGAGGGAGGCACTGA
GATTG
GAGCCTCCGTTCAAGGGTGTTTATC
GTATTGCGTCGAGTGATCACAACACCGAAGGTCTGACCATCCAGAAGAATGATCGCGTATTCCTAGATATTCTCGCTGCTGGCCAAAATGACAAA
GTTTTCCCCGATCCCGAGACCGTCAATGCTCAAAGAGATCAGAGCGGCAAAACTTACATTGTCAGCGACGGTATTACTAG
GTGCCTCGGAGAAGACATCACTGTCCAGATAATGACCCAT
GTCCTGCGTGGCATTTTCGCTATCAAAGACATCAAGCGCGCGCCTGGAAATTCCGGCGTTCTGAATAGGTTCAAGGACCATGACCGTCCAGAGTTGAACTATGCCTACCTTGATGAGCAG
AAATTCATCTCGCCGTGGCCGAATTCATTAGCAGTGATG
TTCACCGATGAATCTTAA

Retrieve as FASTA