Entry information : MlpLDS02
Entry ID 10662
Creation 2012-03-02 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-20 (Catherine Mathe (Scipio))
Peroxidase information: MlpLDS02
Name MlpLDS02
Class Linoleate diol synthase (PGHS like)    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Fungi Basidiomycota Melampsoraceae Melampsora
Organism Melampsora laricis-populina    [TaxId: 203908 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MlpLDS02
start..stop
S start..stop
MlpLDS01 1031 0 2..825 7..793
MlpLDS03 853 0 2..825 10..745
ScomLDS02 406 5e-127 93..783 61..661
PplLDS02 381 2e-118 125..715 3..516
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 264704..264856 153 N° 2 264298..264624 327 N° 3 263932..264217 286 N° 4 263560..263844 285
N° 5 263321..263493 173 N° 6 263089..263215 127 N° 7 262981..263015 35 N° 8 262865..262907 43
N° 9 262704..262801 98 N° 10 262426..262640 215 N° 11 262223..262319 97 N° 12 261888..262133 246
N° 13 261738..261804 67 N° 14 261363..261617 255 N° 15 261210..261301 92  
complement(join(261210..261301,261363..261617,261738..261804,261888..262133,2622 23..262319,262426..262640,262704..262801,262865..262907,262981..263015,263089..2 63215,263321..263493,263560..263844,263932..264217,264298..264624,264704..264856 ))


exon

Literature and cross-references MlpLDS02
DNA ref. JGI genome:   scaffold_20 (264856..261210)
Cluster/Prediction ref. JGI gene:   106834
Protein sequence: MlpLDS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   833
PWM (Da):   %s   92205.11  
PI (pH):   %s   6.19
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPYKNQANQPKPGEALIQSAGYTHVSQIGSAADLPTLSNFPLWRKIAQTEETLGTVSNYLFARGGQHGDYSNYEDSALTDPKPPTSLIYLIIQQILAGTVPSNLVLTKNILTSIGNPFNDRNFQLEQVVAFLARTGRKRHQGPNKFVNAIQGQFINLLWTDLPHPPTTNLDPKHRFRTPDGRDNNLTGLPMLGAANQPYSRSVKPVHPVPAGMAEPEEIFDAILRRPSGFEGFTPHPAQVSSLFFGFANLIIHDLFWSNNGPEVKTCDGSESKEGSEGAPTGGTSNQWQNKTSSYASLDPLYGTNAKEQWQIRDKSQLGRGLLHNDTFSSNRLLLMPPSSSALLVLFSRNHNRAARKVLELNERGAWQSDLSQLTPEQLQQQDDEIFGTARHINCAYYAGIILSDYLAILNTTQVDSNWALDPRAPIKNLLGSTPKATGNSVSVEFNVLYRWHSAVSWSQQWMEDKFSKALPSRNWDEMTGAHLAKASALLQKELNAEAGSDPRNWLSKYETSVPEEGPPELTSEGVYERDAESGKFRDEDIARILRDSTNEVAGTFGARHVPAAMKWIECQGMRTARDVWKLCTLNEFREFIGLKKHDTFEQWNSDPSASAMADLVGHPANIPLHVGLNGEESKKPTVGSGVCLPYTISRAILSDASKHSLSVSNPNEVVSDDSLLRYKVSLVRGDRFFTDSASADVMTDWGLNEVQPDPQNDRINMFTTISHYSVNRFLSPFLTLPSADNIDFFSVPFVVPKHSYSNMQRIGFQKALNYSLNPPPPSNVGFEQVQNGGKTMVCEMSDTSEVEVQRMGLIFGLASLFANLLDSSVLW

Retrieve as FASTA  
Remarks Complete sequence from genomic (14 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTATAAGAACCAAGCGAATCAACCTAAACCAGGAGAAGCTTTGATACAAAGTGCAGGTTACACCCATGTATCACAAATCGGTTCAGCAGCCGATCTGCCCACCTTATCTAATTTT
CCCCTTTGGCGTAAAATTGCTCAAACTGAAGAA
GTGAGTTTTTTGGACCAGAAGTCTCTACCTACATCATCACTTTCCGCTCACTGATTAATGACCATCCATCTTTGTTTAGACACTAGG
GACTGTCTCCAATTATCTCTTTGCTAGGGGAGGACAACATGGGGATTATAGCAATTATGAAGATTCCGCCTTAACTGATCCCAAGCCACCAACTTCATTGATTTACCTCATCATTCAACA
AATTCTGGCCGGAACTGTCCCTTCTAATCTCGTGTTAACCAAAAACATTCTCACGAGCATCGGGAATCCTTTCAATGATCGAAATTTTCAGCTTGAGCAAGTCGTGGCTTTTCTCGCGCG
CACTGGAAGAAAGAGACACCAAGGACCTAATAAATTCGTGAATGCTATACAAGGCCAATTCATCAACTTACTATGGACT
GTAAGCACCTCTATCACGATTCGTTTTGTTTATTGATAAAA
AGACTGATATGATGTTGATTATCTGCTTCCCCCACTCAGGACCTTCCACATCCTCCCACCACCAATCTGGACCCTAAACATCGCTTTAGGACACCCGATGGCCGTGATAACAATCTTACT
GGACTCCCGATGCTTGGAGCTGCCAATCAACCTTATTCAAGATCAGTAAAACCAGTTCATCCTGTGCCAGCTGGCATGGCTGAACCGGAAGAGATATTTGATGCGATCCTTCGTCGTCCA
TCGGGCTTCGAAGGTTTCACGCCACACCCTGCTCAGGTGTCCAGCTTATTCTTTGGCTTTGCAAATCTCATCATTCACGACCTGT
GTCAGTCTTTCTTCCTGGAATTTTCTCCATCTCTG
GAACTGCACTGATCAAAATCGACACTCAAATCGATCGGATTGCAAACTGTAGTCTGGAGCAATAATGGCCCCGAAGTAAAAACATGCGATGGATCCGAATCTAAAGAAGGAAGCGAAGGC
GCCCCAACCGGTGGAACTTCGAATCAATGGCAGAACAAAACTTCGTCCTATGCCTCTTTAGATCCTTTGTACGGGACCAATGCAAAAGAACAATGGCAGATTCGTGATAAAAGCCAACTC
GGCCGTGGTTTATTACACAATGATACATTTTCATCGAACCGATTACTTCTGATGCCACCTTCATCTTCTGCTTTACTCGTACTATTTTCAAGAAATC
GTAAGTGATCTCTAAGGACCATA
TTTGTCAATGAAAATACTCAAAACAAATTTTCCAATCATTTAGATAATCGTGCGGCTAGAAAAGTTCTAGAGCTCAATGAGCGCGGGGCGTGGCAAAGCGACTTGAGTCAACTTACTCCA
GAGCAATTGCAACAACAAGATGATGAGATCTTTGGTACCGCGCGACATATCAATTGTGCCTACTACGCGGGAATCATCCTCAGTGACTATTTACAA
GTTAGTGAAATGCCCCGAGACTAA
TGCCACTTGATAGGTCCACAAGAGATATAGAGTTATACAATATCACATCATCTTGACGATTGTCTGCTTTCTCTTACTTAGGCTATCTTAAATACTACTCAGGTTGACTCGAACTGGGCT
TTAGATCCTAGAGCTCCGATAAAAAATCTTCTTGGTAGTACTCCAAAGGCTACTGGAAATTCAGTTAGTGTAGAGTTCAATGTTCTTT
GTAAGTCACCTTTTTATTGATGTTACAAGTGA
TTCAGAGTAGAAAATAATCTTCGTGACATCTTCGGTCATAGATCGATGGCATTCCGCAGTTTCCTGGTCGCAGACGGTGAGTTACCGTCTCTTTCACAGTTATATCATCCTTGGTATTAA
TTCCCTGCTCTGTAATCTCCTGGTCATAGCAATGGATGGAAGACAAATTTTCTAAAGCTCTGCCTAGCAGAAGTAAGTCCCGAGCGACCCGTTCTACTTTGCATCTCCTCATGTCTAATT
CTTTGGTGTTTATAGATTGGGATGAGATGACCGGAGCGCATTTGGCAAAAGCATCTGCTCTCTTGCAAAAAGAGCTGAATGCCGAGGCAGGATCAGATCCTAGAAATTGGAAGGTCCGTT
TTGTGTCGATTTCATAAGCATGTCGTACACGAATTCTAAGTAATTTACTCTTGCAGTTATCCAAATATGAAACCAGTGTCCCTGAAGAGGGACCACCGGAGTTAACATCAGAAGGAGTGT
ATGAAAGGGATGCCGAAAGTGGCAAATTTCGAGATGAGGATATAGCCAGAATCCTAAGAGATTCGACTAACGAAGTGGCTGGTACGTTTGGAGCTCGACATGTACCAGCAGCAATGAAAT
GGATTGAATGTCAGGGAATGCGAACAGCGAG
GTAGGCATGATACACTCTAGGCACACCCCTCTCATACTATGGAGAAGATGCTAAATATTATCTTGTTGGAACAATTCAAATACATTCTT
GTGGGACAAAATCGCAGAGATGTTTGGAAATTGTGTACATTGAACGAATTCAGAGAGTTCATTGGTTTGAAAAAACACGATACCTTTGAACAATGGAACTCTGATCCATCGGTTGTTCGT
CATGGTTTTCTTTTCCACCACCACTCTTTGGACCAAATCCTTTCAACTCATCTAACTGCTATTTGATCTATTATGGCTTCAAGGCTTCAGCAATGGCAGATCTCGTTGGACATCCAGCAA
ATATTCCACTTCATGTTGGTCTGAATGGTGAAGAATCTAAGAAACCGACAGTAGGTTCAGGTGTATGTCTACCTTACACAATCAGTCGAGCTATCCTGAGTGACGCCAGTAAGCATTCGT
TGAGTGTTTCCAATCCAAATGAGGTGGTTTCTGATGATTCATTATTGCGCTACAAAGTTTCGTTGGTCCGAGGCGACAGATTCTTCACA
GTGGGTCTTTTAAGAAATATTCCGTTTCCAG
ATCACGCCAGTATATCTACCAGATTTGTTTTCTGAAACTCGGTCTGTCTCAGGATTCTGCGAGTGCAGATGTGATGACTGATTGGGGCCTTAACGAGGTACAACCTGATCCGCAAAACGG
TTCATTTGGAGGAATGCTGGAGAAGCTGATACGTAACAATATGTTGGCCACCATTCCCACTAATCCTTTCTTAATTATCACAAGAACTAAACTGAACAACTCGATTTGATGCTTTTCAGA
CCGAATCAATATGTTTACAACGATCTCGCACTACTCTGTAAACCGATTTTTATCACCTTTCTTGACTCTCCCTAGCGCTGATAACATAGACTTCTTCTCAGTTCCTTTTGTCGTTCCCAA
ACATTCATATTCGAATATGCAGCGCATAGGGTTTCAAAAAGCTCTCAATTATTCTTTGAACCCTCCCCCACCATCTAATGTCGGATTTGAGCAAGTCCAAAATGGCGGCAAAACGATGGT
TTGCGAGATGTCAG
GTGCGCCGCGTTCGAGGATCCCCATTGAAGATGATCACTGATGAGCCTTTTGACCATACAGATACATCTGAAGTTGAAGTTCAAAGGATGGGCTTGATCTTTGGAT
TGGCGAGTCTCTTTGCTAATTTGTTGGACTCAAGTGTGTTGTGGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTATAAGAACCAAGCGAATCAACCTAAACCAGGAGAAGCTTTGATACAAAGTGCAGGTTACACCCATGTATCACAAATCGGTTCAGCAGCCGATCTGCCCACCTTATCTAATTTT
CCCCTTTGGCGTAAAATTGCTCAAACTGAAGAA
ACACTAGGGACTGTCTCCAATTATCTCTTTGCTAGGGGAGGACAACATGGGGATTATAGCAATTATGAAGATTCCGCCTTAACTGAT
CCCAAGCCACCAACTTCATTGATTTACCTCATCATTCAACAAATTCTGGCCGGAACTGTCCCTTCTAATCTCGTGTTAACCAAAAACATTCTCACGAGCATCGGGAATCCTTTCAATGAT
CGAAATTTTCAGCTTGAGCAAGTCGTGGCTTTTCTCGCGCGCACTGGAAGAAAGAGACACCAAGGACCTAATAAATTCGTGAATGCTATACAAGGCCAATTCATCAACTTACTATGGACT
GACCTTCCACATCCTCCCACCACCAATCTGGACCCTAAACATCGCTTTAGGACACCCGATGGCCGTGATAACAATCTTACTGGACTCCCGATGCTTGGAGCTGCCAATCAACCTTATTCA
AGATCAGTAAAACCAGTTCATCCTGTGCCAGCTGGCATGGCTGAACCGGAAGAGATATTTGATGCGATCCTTCGTCGTCCATCGGGCTTCGAAGGTTTCACGCCACACCCTGCTCAGGTG
TCCAGCTTATTCTTTGGCTTTGCAAATCTCATCATTCACGACCTGT
TCTGGAGCAATAATGGCCCCGAAGTAAAAACATGCGATGGATCCGAATCTAAAGAAGGAAGCGAAGGCGCCCCA
ACCGGTGGAACTTCGAATCAATGGCAGAACAAAACTTCGTCCTATGCCTCTTTAGATCCTTTGTACGGGACCAATGCAAAAGAACAATGGCAGATTCGTGATAAAAGCCAACTCGGCCGT
GGTTTATTACACAATGATACATTTTCATCGAACCGATTACTTCTGATGCCACCTTCATCTTCTGCTTTACTCGTACTATTTTCAAGAAATC
ATAATCGTGCGGCTAGAAAAGTTCTAGAG
CTCAATGAGCGCGGGGCGTGGCAAAGCGACTTGAGTCAACTTACTCCAGAGCAATTGCAACAACAAGATGATGAGATCTTTGGTACCGCGCGACATATCAATTGTGCCTACTACGCGGGA
ATCATCCTCAGTGACTATTTACAA
GCTATCTTAAATACTACTCAGGTTGACTCGAACTGGGCTTTAGATCCTAGAGCTCCGATAAAAAATCTTCTTGGTAGTACTCCAAAGGCTACTGGA
AATTCAGTTAGTGTAGAGTTCAATGTTCTTT
ATCGATGGCATTCCGCAGTTTCCTGGTCGCAGACGCAATGGATGGAAGACAAATTTTCTAAAGCTCTGCCTAGCAGAAATTGGGATGAG
ATGACCGGAGCGCATTTGGCAAAAGCATCTGCTCTCTTGCAAAAAGAGCTGAATGCCGAGGCAGGATCAGATCCTAGAAATTGGAAG
TTATCCAAATATGAAACCAGTGTCCCTGAAGAG
GGACCACCGGAGTTAACATCAGAAGGAGTGTATGAAAGGGATGCCGAAAGTGGCAAATTTCGAGATGAGGATATAGCCAGAATCCTAAGAGATTCGACTAACGAAGTGGCTGGTACGTTT
GGAGCTCGACATGTACCAGCAGCAATGAAATGGATTGAATGTCAGGGAATGCGAACAGCGAG
AGATGTTTGGAAATTGTGTACATTGAACGAATTCAGAGAGTTCATTGGTTTGAAAAAA
CACGATACCTTTGAACAATGGAACTCTGATCCATCGGTT
GCTTCAGCAATGGCAGATCTCGTTGGACATCCAGCAAATATTCCACTTCATGTTGGTCTGAATGGTGAAGAATCTAAGAAA
CCGACAGTAGGTTCAGGTGTATGTCTACCTTACACAATCAGTCGAGCTATCCTGAGTGACGCCAGTAAGCATTCGTTGAGTGTTTCCAATCCAAATGAGGTGGTTTCTGATGATTCATTA
TTGCGCTACAAAGTTTCGTTGGTCCGAGGCGACAGATTCTTCACA
GATTCTGCGAGTGCAGATGTGATGACTGATTGGGGCCTTAACGAGGTACAACCTGATCCGCAAAACGACCGAATC
AATATGTTTACAACGATCTCGCACTACTCTGTAAACCGATTTTTATCACCTTTCTTGACTCTCCCTAGCGCTGATAACATAGACTTCTTCTCAGTTCCTTTTGTCGTTCCCAAACATTCA
TATTCGAATATGCAGCGCATAGGGTTTCAAAAAGCTCTCAATTATTCTTTGAACCCTCCCCCACCATCTAATGTCGGATTTGAGCAAGTCCAAAATGGCGGCAAAACGATGGTTTGCGAG
ATGTCAG
ATACATCTGAAGTTGAAGTTCAAAGGATGGGCTTGATCTTTGGATTGGCGAGTCTCTTTGCTAATTTGTTGGACTCAAGTGTGTTGTGGTGA

Retrieve as FASTA