Entry information : MlpLDS03
Entry ID 10663
Creation 2012-03-02 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-20 (Catherine Mathe (Scipio))
Peroxidase information: MlpLDS03
Name MlpLDS03
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Melampsoraceae Melampsora
Organism Melampsora laricis-populina    [TaxId: 203908 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MlpLDS03
start..stop
S start..stop
MlpLDS01 1320 0 5..1083 2..1158
MlpLDS02 937 0 10..745 2..825
ScomLDS02 385 9e-117 110..668 70..619
GluxLDS02 377 7e-114 77..683 36..625
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 471111..471290 180 N° 2 470715..471041 327 N° 3 470355..470640 286 N° 4 469970..470260 291
N° 5 469723..469895 173 N° 6 469261..469303 43 N° 7 469091..469194 104 N° 8 468802..469016 215
N° 9 468628..468724 97 N° 10 468408..468552 145 N° 11 468299..468330 32 N° 12 468122..468231 110
N° 13 467693..467903 211 N° 14 467428..467618 191 N° 15 467112..467232 121 N° 16 466557..467027 471
N° 17 466420..466492 73 N° 18 466147..466328 182  
complement(join(466147..466328,466420..466492,466557..467027,467112..467232,4674 28..467618,467693..467903,468122..468231,468299..468330,468408..468552,468628..4 68724,468802..469016,469091..469194,469261..469303,469723..469895,469970..470260 ,470355..470640,470715..471041,471111..471290))


exon

Literature and cross-references MlpLDS03
DNA ref. JGI genome:   scaffold_20 (471290..466147)
EST ref. GenBank:   GR767567.1 [5' end]   GR767568.1 [3' end]
Protein sequence: MlpLDS03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1084
PWM (Da):   %s   120595.1  
PI (pH):   %s   6.84
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSQQTTANRPYHSQQSSQPKAGEALVQTRGYTHLLQIGSATDLPTSSDSGLWRRVAQFQETAGIVSHYLFSKGGQYGHLDNYEESATTDNKKSTSLAYLAVQQTLAGLVPENLAMVANLLTSVGKPLDDRKLQLEEVVAFLSRAGKRRHNAPNKYVDAAQNQFITLLWNDLSHPPTVDLNPKHRFRKADGSDNNLTGDPLLGAANQPYSRSVRPVHPVPTHIAEPEDMFDAILRRPTGYEGFTPHPARISSLFFGFANIVIHDIFWTNNREEVKVPNKYHESDQNTEQADDKPKKPSPWQNLTSSYASLDPLYGVSDKEQASIRDKEQLGRGLLYNDTFASDRLLMMPPASCALLVLFSRNHNRIAKKLLELNERGSWKSDLSKLSEEELKQQDDEIFGTARHVNCGYYAGIILGDYLQWLESTFEKALPSRKWDEMNMSTLMDAIKILKTKLNAADENAHNPKVWLSKREVRIPVEGPPVVESEGVYERDSQSSKFRDEDLARILKDSTYEVAGAFGARHVPAVMRWIECQGMRTARDVWKLCTLNEFRAFIGLKEFQTFQEWNSDPEASAMEDLVGHPANIPLHVGLHGEEAKKPRLGSGVCLPYTISRAILSDAIALVRGDRFYDNATADVMTNWGLADCQPDPQNGAPGGMLEKLIRENLHQKALNYAIDPPVQPIIGYKQIQSGERTLVYELSGMHGIQVISRLIADTILSSKDTPRVEAQRMGMIVGDHMNSNIKLVYKAVEKVMYHQDVKQYHDFIHSRIQECSTRRSPVSSDETVDVLRDVTNPLVSGCYCYLTESPQRSFKARAAARIAASGLTWQIKSHIQGCAPSSVGDTFKKGASMAMMGALGALEETVKFVSGQDPGFKGGHGDTLAFYKTLTAENNAQVDPLSPDELAADCLRAISTLAFTIVNGTANALDYLLPEVTKPDEVPRIRETLETIIKGNNEPGLHEAFSRHALEATRLGHWNESLRGMVFKSEYQNRNSRSLPIGIIDSDFRLDRDTSSYLRLLDVEGYCLSVFENIVPIVISQVLSLPQVRRAPGGQGKLEKLKIAGSNSGIPTMHIRYDGTKS

Retrieve as FASTA  
Remarks Complete sequence from genomic (17 introns) and 3 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCACAACAAACCACTGCCAACAGACCTTATCACTCTCAACAGTCTTCCCAGCCTAAAGCTGGTGAAGCTTTAGTTCAGACTAGAGGATATACTCATCTATTACAGATTGGTTCAGCT
ACTGATTTACCTACTTCAAGCGATTCTGGATTATGGCGTAGAGTTGCTCAATTCCAAGAG
GTACGTTCTTGTGATCAATTGAGTTTTAGTTTTCTAGAGGATGATTCTGACATCCTTTGA
ATTTTTCAGACCGCTGGAATTGTCTCGCATTACCTGTTCTCCAAGGGTGGTCAATACGGTCATTTGGATAACTATGAAGAATCAGCTACCACTGATAATAAAAAATCAACTTCATTGGCT
TACCTCGCTGTTCAACAAACCTTGGCGGGTTTGGTACCAGAGAACCTTGCTATGGTCGCGAACTTATTGACTAGCGTTGGAAAACCATTGGATGACCGAAAACTTCAACTTGAAGAAGTC
GTCGCTTTTCTCTCTCGTGCTGGAAAGAGAAGACATAACGCTCCTAATAAATATGTTGATGCGGCTCAGAATCAATTTATCACTTTGCTTTGGAAT
GTGAGTGTTTCTGAACTTTGTCCT
TTTTTAAATGTATTGAAACCCAATATTTGCCTCGCATGAAAAATAAACAGGATCTCTCTCATCCTCCAACAGTGGATTTGAATCCCAAGCATCGCTTCAGGAAAGCTGATGGAAGTGACA
ACAACCTGACTGGTGATCCGCTCCTTGGAGCTGCCAATCAACCGTATTCCAGATCTGTTCGACCGGTTCATCCTGTTCCGACTCACATAGCTGAGCCCGAAGACATGTTCGATGCTATTC
TACGTCGTCCTACGGGGTACGAAGGTTTTACCCCTCACCCAGCTCGCATTTCCAGTTTATTCTTTGGTTTTGCGAATATCGTCATTCACGACATAT
GTCAGTTCATTTCTTTTGTGATTG
ATCTTGGTCTACGAGGAATTTTGGAAATATAAGCTGACATATGATTGTTCATGGTTGCCATTGCCATCAGTCTGGACCAACAATCGCGAAGAAGTCAAAGTCCCGAACAAATATCACGAA
TCGGATCAGAACACAGAACAAGCCGACGACAAACCCAAGAAGCCCAGCCCGTGGCAGAATTTGACGTCATCTTATGCTTCTTTGGATCCTTTATATGGCGTCAGCGATAAGGAACAAGCA
AGTATACGCGACAAAGAACAGCTTGGTCGTGGCTTGTTGTATAACGATACCTTTGCCTCGGATCGATTGCTCATGATGCCGCCAGCTTCATGTGCTTTGCTTGTTCTCTTCTCCAGGAAT
C
GTAAGTGAGGATTAAAGACGGGACTTGAACTCTTCACCCGAAACTCACTCTTGATCTGTCTTTTTCCAAAATAGACAACCGCATCGCCAAGAAGTTACTAGAACTCAATGAACGCGGTA
GTTGGAAATCAGACCTGAGCAAACTGAGCGAAGAAGAATTGAAACAACAAGACGATGAGATCTTTGGTACGGCACGACACGTTAATTGCGGTTATTACGCTGGCATCATCCTTGGAGATT
ATCTACAG
GTGGGCCCTTTGCTTGTAAATTTCCATAGATTTACGCGTAAAGAAACTCATCGGCCCCTTGATCATCACTCGCTTCGCACTCCCCAAGGCCATTTTGAACACCACGCAAGCT
GATAGCGATTGGAGTCTCAACCCTAGACTTCCGATCAAAAGCATTTTAGGTACCACTCCGAAGGCTACTGGAAATTCGACTAGCGTCGAGTTCAATACCCTTTGTGGGTTTAATCCGTTC
CACACACAGCCTATAATTTGTGAATGAAAGAACTGAATAGCGCCTCGAGTTTTTTGTTCCCAGATCGATGGCACGCCCCGATCTCGTGGTCTCAGACCGTAAGTTGAATCAAGATGCTTA
TTTATATGATAGAAGACTGTTCTTAGTATAAGCTCATCATTCTTTCTGCCTCATTATATTTGTTTAGCAATGGCTTGAGTCAACTTTTGAAAAAGCTCTACCAAGTCGGAGTGAGTGCGA
GAGCCTTTGTCCTGAGAAATATTCACGACCTATTGATAACAGAGGGTTTTAACTAGAATGGGACGAGATGAATATGTCGACTTTGATGGATGCGATTAAAATCTTGAAAACCAAGTTGAA
TGCTGCCGATGAAAATGCTCATAATCCCAAAGTTTGGAAG
GTTAGTGCTGACAATTTTGAGATTTGAGATTTGCTTCCGCATCTAGCTTGCTGATAGATATTTGATTTTATCAGTTATCG
AAACGAGAAGTCAGAATACCTGTGGAGGGTCCACCCGTGGTGGAGTCCGAAGGTGTTTATGAGAGGGACTCGCAAAGTAGTAAATTCCGCGATGAGGATTTGGCGAGGATCTTGAAGGAT
TCTACATATGAAGTTGCAGGTGCCTTCGGAGCCAGACATGTACCAGCAGTAATGCGCTGGATTGAATGCCAAGGGATGCGGACGGCGAG
GTGTGCATCAAAGGAATAGGTCTACCAAGTG
GATCTCTCTTAAGATTTGACATGCTTGCGCTTTTTGATTTCTGCAGAGATGTTTGGAAATTATGTACGCTAAACGAATTCAGGGCGTTTATTGGCTTGAAGGAATTCCAGACATTCCAAG
AGTGGAATTCGGACCCAGAAATT
GTCAGTAAGACCTTCTTGCATCCAAGCCCACGAAACTAGACCAACTGATCACAAGACATAAATTTGAATCCACAGGCTTCTGCAATGGAGGATCTTG
TCGGACACCCAGCCAACATTCCGCTTCATGTTGGTCTGCACGGAGAGGAAGCCAAAAAACCAAGATTGGGATCGGGTGTTTGTCTTCCTTATACCATCAGTCGAGCTATACTAAGTGACG
CAA
GTTAGTATCGTTCTTGTGTAACCTTTGCTTTTAAAAAAACACTCATCTTTACCGTATCCTGCTTTTGCTATTCATAGTTGCATTGGTTCGAGGAGATCGCTTCTATACGGTATTTAG
GAACTTGACTCTATCACCCTATCTGACCTCCACGATCCTGAGATATGTTTTTTTCTTAGGATAATGCAACTGCAGATGTTATGACCAATTGGGGACTCGCTGACTGCCAGCCTGATCCTC
AAAACGGCGCACCTGGAGGAATGCTCGAAAAACTGATACGCGAGAATCT
GTGAGCTTTTTGAGCCGCAGTCCTGTCTTGCATTATGGCCAACTGATTTCCTCCATTGAGACTCTCAGACC
CAACCAATACGCGTTTAATGATGTTGCACTACTATGTAAGTAAAACTTCAAATATTTTACAAGATGTCGCTTCCTCTGATATGATCGCTTGTTATCAGTTCCCTTCATACTACCTCAGCA
CTCATATTCCGTCATGCAGAAGATTAGCCACCAAAAGGCACTCAACTATGCGATCGATCCTCCCGTACAACCTATCATTGGTTATAAACAGATCCAGAGCGGTGAAAGAACGCTGGTTTA
TGAGCTTTCAGGTATGCATGGCATCCAAGTCATCTCGAGGTTGATTGCTGATACTATCCTATCATCTAAAGATACTCCCAGGGTAGAAGCTCAGAGGATGGGCATGATCGTCGGTTTG
GT
AAGTTGGTATTGAGTACTCGATTGTGTTTTTCGCGTGTGATGCTTAGACCACCCGTAATTTATCTTTCTCAGGACCACATGAATTCCAACATCAAGCTCGTCTATAAGGCAGTGGAGAAA
GTGATGTATCATCAAGATGTAAAACAATACCATGATTTCATTCACAGCCGCATTCAAGAATGCTCCACGAGGCGAAGCCCAGTTTCATCTGATGAGACAGTTGATGTTCTTCGGGATGTC
ACAAACCCTTTGGTTTCGGGATG
GTGAGTGATCTCACTCAGATACACTTCAACAATTTGCGCTGATGTATCCTCTTAAGGCTCGCTCATGTGTTCGGCCTTGTCGAGACTGGCATTCACT
CGCAACAGCTTCTTCTATCTACCTTGAGTGATGTGTAAGTTCGAACCAAAGCATAAAACCCTCCAGCCTACATCCTGAAGTAAATTCTGTACCCCTAGTTATTGCTATCTAACCGAGTCA
CCTCAGCGATCTTTCAAAGCTCGTGCAGCTGCGCGAATAGCTGCCTCTGGGTTGACCTGGCAGATCAAATCTCACATTCAAGGATGCGCCCCTTCTCAC
GTAAGAGAAAACCCCGAACTG
ATCTCTACAAGCCTTATACTTTTCCAAGACTTACCCCCTCTGCTTTCGAATTTCGGGATACAGTCAGTTGGAGATACGTTCAAGAAGGGCGCATCTATGGCAATGATGGGGGCTTTGGGA
GCGCTTGAAGAGACTGTCAAATTCGTGTCTGGTCAAGATCCTGGATTTAAAGGCGGACATGGCGATACCTTGGCATTTTATAAGACCTTGACGGCTGAGAACAATGCTCAGGTTGACCCA
TTGTCGCCCGATGAACTAGCAGCTGACTGTTTGAGAGCAATTTCCACCTTGGCCTTTACCATCGTAAATGGTACGGCAAATGCGCTGGACTATCTTTTGCCCGAAGTTACCAAGCCGGAT
GAAGTTCCCAGAATTCGAGAAACTTTGGAAACGATCATCAAGGGAAACAACGAACCTGGACTACATGAGGCATTTTCTAGGCATGCATTGGAAGCCACACGTCTTGGTCACTGGAATGAA
TCTTTGCGTGGTATGGTATTCAAATCCGAATATCAAAATAGGAATTCTCGCTCT
GTGAGGATCACTCGACTTATCTTTCTTTGAAACAAGAGACTGAATAACGTGATACTCCTTTTAGCT
ACCTATTGGAATCATTGACAGCGATTTTCGACTTGATCGAGATACCTCTTCCTACTTGCGCTTGTTAGATG
GTAAGCTCGTCTATGTATGGTGCCAATCTAATCAAACGATCAAATTCTG
ATTCGAGACCGTTTCCTATCTGTCTTTCTCATTTGATTACAGTTGAGGGATATTGTCTCTCGGTCTTTGAAAACATTGTGCCTATCGTAATCAGCCAGGTTTTATCACTTCCTCAAGTCA
GACGGGCGCCCGGTGGTCAAGGGAAGTTGGAAAAACTCAAGATTGCGGGTTCGAATTCAGGTATCCCTACGATGCATATTAGATATGATGGTACCAAATCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCACAACAAACCACTGCCAACAGACCTTATCACTCTCAACAGTCTTCCCAGCCTAAAGCTGGTGAAGCTTTAGTTCAGACTAGAGGATATACTCATCTATTACAGATTGGTTCAGCT
ACTGATTTACCTACTTCAAGCGATTCTGGATTATGGCGTAGAGTTGCTCAATTCCAAGAG
ACCGCTGGAATTGTCTCGCATTACCTGTTCTCCAAGGGTGGTCAATACGGTCATTTGGAT
AACTATGAAGAATCAGCTACCACTGATAATAAAAAATCAACTTCATTGGCTTACCTCGCTGTTCAACAAACCTTGGCGGGTTTGGTACCAGAGAACCTTGCTATGGTCGCGAACTTATTG
ACTAGCGTTGGAAAACCATTGGATGACCGAAAACTTCAACTTGAAGAAGTCGTCGCTTTTCTCTCTCGTGCTGGAAAGAGAAGACATAACGCTCCTAATAAATATGTTGATGCGGCTCAG
AATCAATTTATCACTTTGCTTTGGAAT
GATCTCTCTCATCCTCCAACAGTGGATTTGAATCCCAAGCATCGCTTCAGGAAAGCTGATGGAAGTGACAACAACCTGACTGGTGATCCGCTC
CTTGGAGCTGCCAATCAACCGTATTCCAGATCTGTTCGACCGGTTCATCCTGTTCCGACTCACATAGCTGAGCCCGAAGACATGTTCGATGCTATTCTACGTCGTCCTACGGGGTACGAA
GGTTTTACCCCTCACCCAGCTCGCATTTCCAGTTTATTCTTTGGTTTTGCGAATATCGTCATTCACGACATAT
TCTGGACCAACAATCGCGAAGAAGTCAAAGTCCCGAACAAATATCAC
GAATCGGATCAGAACACAGAACAAGCCGACGACAAACCCAAGAAGCCCAGCCCGTGGCAGAATTTGACGTCATCTTATGCTTCTTTGGATCCTTTATATGGCGTCAGCGATAAGGAACAA
GCAAGTATACGCGACAAAGAACAGCTTGGTCGTGGCTTGTTGTATAACGATACCTTTGCCTCGGATCGATTGCTCATGATGCCGCCAGCTTCATGTGCTTTGCTTGTTCTCTTCTCCAGG
AATC
ACAACCGCATCGCCAAGAAGTTACTAGAACTCAATGAACGCGGTAGTTGGAAATCAGACCTGAGCAAACTGAGCGAAGAAGAATTGAAACAACAAGACGATGAGATCTTTGGTACG
GCACGACACGTTAATTGCGGTTATTACGCTGGCATCATCCTTGGAGATTATCTACAG
CAATGGCTTGAGTCAACTTTTGAAAAAGCTCTACCAAGTCGGAAATGGGACGAGATGAATATG
TCGACTTTGATGGATGCGATTAAAATCTTGAAAACCAAGTTGAATGCTGCCGATGAAAATGCTCATAATCCCAAAGTTTGGAAG
TTATCGAAACGAGAAGTCAGAATACCTGTGGAGGGT
CCACCCGTGGTGGAGTCCGAAGGTGTTTATGAGAGGGACTCGCAAAGTAGTAAATTCCGCGATGAGGATTTGGCGAGGATCTTGAAGGATTCTACATATGAAGTTGCAGGTGCCTTCGGA
GCCAGACATGTACCAGCAGTAATGCGCTGGATTGAATGCCAAGGGATGCGGACGGCGAG
AGATGTTTGGAAATTATGTACGCTAAACGAATTCAGGGCGTTTATTGGCTTGAAGGAATTC
CAGACATTCCAAGAGTGGAATTCGGACCCAGAAATT
GCTTCTGCAATGGAGGATCTTGTCGGACACCCAGCCAACATTCCGCTTCATGTTGGTCTGCACGGAGAGGAAGCCAAAAAACCA
AGATTGGGATCGGGTGTTTGTCTTCCTTATACCATCAGTCGAGCTATACTAAGTGACGCAA
TTGCATTGGTTCGAGGAGATCGCTTCTATACGGATAATGCAACTGCAGATGTTATGACC
AATTGGGGACTCGCTGACTGCCAGCCTGATCCTCAAAACGGCGCACCTGGAGGAATGCTCGAAAAACTGATACGCGAGAATCT
CCACCAAAAGGCACTCAACTATGCGATCGATCCTCCC
GTACAACCTATCATTGGTTATAAACAGATCCAGAGCGGTGAAAGAACGCTGGTTTATGAGCTTTCAGGTATGCATGGCATCCAAGTCATCTCGAGGTTGATTGCTGATACTATCCTATCA
TCTAAAGATACTCCCAGGGTAGAAGCTCAGAGGATGGGCATGATCGTCGGTTTG
GACCACATGAATTCCAACATCAAGCTCGTCTATAAGGCAGTGGAGAAAGTGATGTATCATCAAGAT
GTAAAACAATACCATGATTTCATTCACAGCCGCATTCAAGAATGCTCCACGAGGCGAAGCCCAGTTTCATCTGATGAGACAGTTGATGTTCTTCGGGATGTCACAAACCCTTTGGTTTCG
GGATG
TTATTGCTATCTAACCGAGTCACCTCAGCGATCTTTCAAAGCTCGTGCAGCTGCGCGAATAGCTGCCTCTGGGTTGACCTGGCAGATCAAATCTCACATTCAAGGATGCGCCCCT
TCTCAC
TCAGTTGGAGATACGTTCAAGAAGGGCGCATCTATGGCAATGATGGGGGCTTTGGGAGCGCTTGAAGAGACTGTCAAATTCGTGTCTGGTCAAGATCCTGGATTTAAAGGCGGA
CATGGCGATACCTTGGCATTTTATAAGACCTTGACGGCTGAGAACAATGCTCAGGTTGACCCATTGTCGCCCGATGAACTAGCAGCTGACTGTTTGAGAGCAATTTCCACCTTGGCCTTT
ACCATCGTAAATGGTACGGCAAATGCGCTGGACTATCTTTTGCCCGAAGTTACCAAGCCGGATGAAGTTCCCAGAATTCGAGAAACTTTGGAAACGATCATCAAGGGAAACAACGAACCT
GGACTACATGAGGCATTTTCTAGGCATGCATTGGAAGCCACACGTCTTGGTCACTGGAATGAATCTTTGCGTGGTATGGTATTCAAATCCGAATATCAAAATAGGAATTCTCGCTCT
CTA
CCTATTGGAATCATTGACAGCGATTTTCGACTTGATCGAGATACCTCTTCCTACTTGCGCTTGTTAGATG
TTGAGGGATATTGTCTCTCGGTCTTTGAAAACATTGTGCCTATCGTAATC
AGCCAGGTTTTATCACTTCCTCAAGTCAGACGGGCGCCCGGTGGTCAAGGGAAGTTGGAAAAACTCAAGATTGCGGGTTCGAATTCAGGTATCCCTACGATGCATATTAGATATGATGGT
ACCAAATCATGA

Retrieve as FASTA