Entry information : AdelAPx-CcP
Entry ID 10672
Creation 2012-03-05 (Christophe Dunand)
Last sequence changes 2012-03-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: AdelAPx-CcP
Name AdelAPx-CcP
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Auriculariaceae Auricularia
Organism Auricularia delicata    [TaxId: 160860 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdelAPx-CcP
start..stop
S start..stop
ParcAPx-CcP02 443 1e-151 11..485 13..506
ScomAPx-CcP01 442 2e-151 12..514 11..524
ParcAPx-CcP01 420 2e-142 6..503 7..521
DsAPx-CcP 414 3e-140 5..460 7..468
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 112867..113070 204 N° 2 112708..112800 93 N° 3 112590..112656 67 N° 4 112484..112529 46
N° 5 112258..112427 170 N° 6 112184..112200 17 N° 7 112043..112137 95 N° 8 111872..111985 114
N° 9 111639..111822 184 N° 10 111235..111585 351 N° 11 110946..111173 228  
complement(join(110946..111173,111235..111585,111639..111822,111872..111985,1120 43..112137,112184..112200,112258..112427,112484..112529,112590..112656,112708..1 12800,112867..113070))


exon

Literature and cross-references AdelAPx-CcP
DNA ref. JGI genome:   scaffold_105 (113070..110946)
Protein sequence: AdelAPx-CcP
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   523 (500)
PWM (Da):   %s   56984.07 (54459.7)  
PI (pH):   %s   4.66 (4.57) Peptide Signal:   %s   cut: 23 range:23-522
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTFFKLQALSLISSAAARYAWPDPKYEAIEQLRWDQRGYGSTALFTPCDTFIGGTQTGRSNSADWVRAAYHDAATYNAEDGTGGLDASIRFEEEQQRAENVGTGFANTFFFVNLIANRYVTYADGLAAAATIMIENCGGPVIDYRGGRVDATEPNKPGVPEPQQSLEEHVASFKKQGFNKTEMIGLVACGHSGGVQHSSFPDLVPELNDPANTESNARFDTTFRVFDNVATEYIKGTTQNPLVVGSNDTLNSDKRIFGSDGNATMAALAADPEHFARTCATLIAKMLDTVPRGVRLTDVITPIPVKPYDVQISYNANGTLNFIGGNVRLWNVAENPNRVVRGVVTDKNGVALKPVVLSHSSFQIGTAAGERFTSTWYTWPTLPAMDAAASIAKFHYEIDEGDGTPVRVADQDGLGFPMRDDVLFSETSCNYDSTGFPRPWRFDVAVRKGLNASRIFLQTYSLPTLTLEPMLREVGSGSYDLWSADVLPENDGIWTVSYQIEGMTIDVPGKHRIMLIDCPA

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCTTCTTCAAGCTCCAAGCGTTGTCACTCATTTCGTCTGCCGCGGCGAGGTACGCCTGGCCGGACCCGAAGTACGAGGCGATCGAGCAGCTGCGCTGGGACCAGCGCGGGTATGGC
TCGACGGCGCTCTTCACGCCGTGCGACACGTTCATCGGCGGCACGCAGACTGGCAGGAGCAACTCGGCGGACTGGGTCCGCGCG
GTGCGTGCGGACTGATGCCCGGTTCTAGTTCGTCGA
CTGACTCGCACCATACTGGCGCACTGGCAGGCGTACCACGACGCCGCGACCTATAATGCGGAAGACGGAACGGGCGGCTTGGACGCGAGCATCCGCTTCGAAGAGGAGCAGCAGCGCGCG
GAG
GTCTGCATCAGTCTTTCGCCGACTTCGCCGAGTCCTGACGTGTGCGAGCAGAATGTGGGCACGGGCTTTGCTAACACGTTCTTCTTCGTGAACCTCATCGCAAACCGCTACGTAACA
T
GTGCGCGCTCACTTTCTCCGTCGCGAGGTCGGAATTCACATTGACTGTAACCTGTTCCAGATGCGGATGGGCTGGCGGCTGCTGCGACAATCATGATAGAGAACTGGTCAGTGCGGCCG
CGCCCGGCGACCTACAGCGATTGAATAGCTATTCCTTTCATAGCGGCGGGCCCGTCATTGACTACCGCGGGGGGCGGGTCGACGCCACAGAGCCCAATAAGCCCGGCGTCCCGGAGCCAC
AGCAGTCGCTCGAAGAACACGTCGCGAGCTTCAAGAAGCAAGGGTTCAACAAGACTGAGATGATTGGTCTCGTTGCATGCGGCCATTCGTTTG
GTGCGCCCAACCCTGCAGAGCCTTTCA
AGTTTCAGTGTCTAATTGCCGGTGTACCAGGAGGCGTCCAGCACTCCGTCAGTGCCTTATCCGCCGTTGGGACAGCCTCTCACCCAGTAGCAGTCGTTCCCCGACCTCGTGCCGGAGCTC
AACGATCCCGCAAACACCGAATCGAACGCTCGATTCGACACGACGTTCCGAGTGTTCGACAACGCAGT
GTAAGCACGGGTTCCCCAGGCCGGTTTCATAGGCTTTGCGATACTGAGCCCT
CGAAGCGCAACCGAATATATCAAAGGCACGACGCAGAATCCCCTCGTCGTAGGGTCAAACGACACGCTCAACTCGGACAAGCGCATCTTCGGGAGCGACGGCAACGCGACGATGGCCGCG
TACGCTCGTGCCCCCTTCCTGTAGTACGACGCTAAGCACGGCTGGCAGCCTCGCAGCCGACCCAGAGCACTTCGCGCGCACCTGCGCGACGCTGATCGCGAAGATGCTGGACACGGTGCC
GCGCGGCGTGAGGCTCACCGACGTGATCACGCCCATCCCCGTCAAACCGTACGACGTGCAGATCAGCTACAACGCCAACGGGACGCTCAACTTCATTGGGGGCAACGTTCGC
GTACGTCG
AGTCCGTTGATCGGATTTCGCCTTGGGAAACTAATGCGGCTGCAGCTGTGGAATGTCGCTGAGAATCCGAACCGTGTCGTGCGCGGTGTCGTGACGGACAAGAACGGCGTCGCCTTGAAG
CCAGTCGTCCTCAGCCACAGTAGTTTCCAGATTGGCACCGCCGCCGGCGAGCGGTTCACCTCAACGTGGTACACATGGCCGACGCTGCCTGCAATGGACGCCGCGGCGTCTATAGCGAAA
TTCCACTATGAAATTGACGAGGGCGACGGCACTCCGGTGCGCGTGGCAGACCAGGATGGGCTGGGATTCCCGATGCGGGACGACGTGCTCTTCTCCGAGACGTCGTGCAACTACGACTCC
ACCGGCTTCCCACGCCCGTGGCGGTTCGACGTCGCC
GTCAGTCTCTCCACTCCTCACCACATCACTCTGTTTGCTGAACTCGAACGGATGATCGTAGGTCCGCAAGGGTCTCAACGCGTC
GCGCATCTTCCTGCAGACGTATTCGCTGCCCACGCTCACGCTCGAGCCGATGCTGCGCGAGGTCGGAAGCGGGTCGTATGATCTGTGGTCTGCCGATGTCCTCCCGGAGAACGATGGGAT
ATGGACTGTGTCTTATCAGATTGAAGGTATGACTATCGACGTCCCGGGGAAGCATCGTATCATGTTAATCGATTGCCCTGCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCTTCTTCAAGCTCCAAGCGTTGTCACTCATTTCGTCTGCCGCGGCGAGGTACGCCTGGCCGGACCCGAAGTACGAGGCGATCGAGCAGCTGCGCTGGGACCAGCGCGGGTATGGC
TCGACGGCGCTCTTCACGCCGTGCGACACGTTCATCGGCGGCACGCAGACTGGCAGGAGCAACTCGGCGGACTGGGTCCGCGCG
GCGTACCACGACGCCGCGACCTATAATGCGGAAGAC
GGAACGGGCGGCTTGGACGCGAGCATCCGCTTCGAAGAGGAGCAGCAGCGCGCGGAG
AATGTGGGCACGGGCTTTGCTAACACGTTCTTCTTCGTGAACCTCATCGCAAACCGCTACGTA
ACAT
ATGCGGATGGGCTGGCGGCTGCTGCGACAATCATGATAGAGAACTGCGGCGGGCCCGTCATTGACTACCGCGGGGGGCGGGTCGACGCCACAGAGCCCAATAAGCCCGGCGTCCCG
GAGCCACAGCAGTCGCTCGAAGAACACGTCGCGAGCTTCAAGAAGCAAGGGTTCAACAAGACTGAGATGATTGGTCTCGTTGCATGCGGCCATTCGTTTG
GAGGCGTCCAGCACTCCTCG
TTCCCCGACCTCGTGCCGGAGCTCAACGATCCCGCAAACACCGAATCGAACGCTCGATTCGACACGACGTTCCGAGTGTTCGACAACGCAGT
CGCAACCGAATATATCAAAGGCACGACG
CAGAATCCCCTCGTCGTAGGGTCAAACGACACGCTCAACTCGGACAAGCGCATCTTCGGGAGCGACGGCAACGCGACGATGGCCGC
CCTCGCAGCCGACCCAGAGCACTTCGCGCGCACC
TGCGCGACGCTGATCGCGAAGATGCTGGACACGGTGCCGCGCGGCGTGAGGCTCACCGACGTGATCACGCCCATCCCCGTCAAACCGTACGACGTGCAGATCAGCTACAACGCCAACGGG
ACGCTCAACTTCATTGGGGGCAACGTTCGC
CTGTGGAATGTCGCTGAGAATCCGAACCGTGTCGTGCGCGGTGTCGTGACGGACAAGAACGGCGTCGCCTTGAAGCCAGTCGTCCTCAGC
CACAGTAGTTTCCAGATTGGCACCGCCGCCGGCGAGCGGTTCACCTCAACGTGGTACACATGGCCGACGCTGCCTGCAATGGACGCCGCGGCGTCTATAGCGAAATTCCACTATGAAATT
GACGAGGGCGACGGCACTCCGGTGCGCGTGGCAGACCAGGATGGGCTGGGATTCCCGATGCGGGACGACGTGCTCTTCTCCGAGACGTCGTGCAACTACGACTCCACCGGCTTCCCACGC
CCGTGGCGGTTCGACGTCGCC
GTCCGCAAGGGTCTCAACGCGTCGCGCATCTTCCTGCAGACGTATTCGCTGCCCACGCTCACGCTCGAGCCGATGCTGCGCGAGGTCGGAAGCGGGTCG
TATGATCTGTGGTCTGCCGATGTCCTCCCGGAGAACGATGGGATATGGACTGTGTCTTATCAGATTGAAGGTATGACTATCGACGTCCCGGGGAAGCATCGTATCATGTTAATCGATTGC
CCTGCCTGA

Retrieve as FASTA