Entry information : FmeCcP (Fomme-CCP)
Entry ID 10679
Creation 2012-03-05 (Christophe Dunand)
Last sequence changes 2012-03-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-22 (Catherine Mathe (Scipio))
Peroxidase information: FmeCcP (Fomme-CCP)
Name (synonym) FmeCcP (Fomme-CCP)
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Hymenochaetaceae Fomitiporia
Organism Fomitiporia mediterranea    [TaxId: 208960 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value FmeCcP
start..stop
S start..stop
PoCcP_PC9 562 0 7..384 6..374
SnivCcP01 555 0 4..382 1..366
SlacCcP01 554 0 4..383 3..372
PoCcP_PC15 552 0 7..375 6..365
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2351111..2351431 321 N° 2 2351486..2351534 49 N° 3 2351594..2351675 82 N° 4 2351728..2351881 154
N° 5 2351941..2352074 134 N° 6 2352120..2352269 150 N° 7 2352324..2352479 156 N° 8 2352531..2352639 109
join(2351111..2351431,2351486..2351534,2351594..2351675,2351728..2351881,2351941 ..2352074,2352120..2352269,2352324..2352479,2352531..2352639)


exon

Literature and cross-references FmeCcP (Fomme-CCP)
DNA ref. JGI genome:   scaffold_6 (2351111..2352639)
Cluster/Prediction ref. JGI gene:   156444
Protein sequence: FmeCcP (Fomme-CCP)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   385
PWM (Da):   %s   42708.43  
PI (pH):   %s   9.23
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSMLAALRTPARRTAFAAAPRAAMRTSMRVRPSLRKYATESAPNPEPKSGSNAWLYGSVGAAALVSVGYYVYATSDVGREAGTAAKSAGQAVKVKANFVPTKEDYQKVYNEIVNILEENGEYDDGSYGPVLVRLAWHSSGTYDKETKTGGSNYAAMRFEPESLHGANNGLNVARDLLEKVKAKFPWISYGDLWTLAGVCAVEMGGPKIPWRAGRIDGFSKDATPDGRLPDASQGSDHVRNIFYRMGSRFNDQEIVALLGAHALGRCHTDRSGFEGPWTFSPITFTNDFFTLLFNEKWIWRKWSGPKQLQDKKTGSLMMLPTDYVLVQDKNFKKFAKAYADNQDIFFEDFSKAFAKLLELGVPESQWVAQEPWLLKNTDEQKSQ

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCATGCTCGCTGCCCTCCGCACCCCCGCCCGTCGGACCGCATTTGCCGCAGCGCCTCGCGCTGCTATGCGCACTAGCATGCGCGTTCGTCCCTCCTTACGCAAATACGCAACTGAG
TCCGCCCCGAACCCCGAGCCCAAGTCGGGTAGCAATGCCTGGCTCTATGGCTCAGTTGGTGCTGCTGCACTCGTATCCGTTGGATACTACGTCTACGCCACATCGGATGTGGGCAGAGAG
GCGGGCACTGCGGCCAAGTCTGCTGGCCAGGCTGTGAAGGTCAAGGCCAACTTCGTCCCGACGAAGGAAGATTACCAGAAG
GTTAGACACCTTGCAGTGAAAATTTTCCGTGTCCTCTCT
ATTAATACTCCATAGGTTTACAACGAGATTGTCAACATTTTGGAGGAAAATGGCGAATATGATGGTATGTCTTTATGCTTCCTAAAGAGCCCGAAAGATTCTTATCTATTCGTTCGCACG
AAGATGGTTCTTACGGTCCCGTCCTCGTTCGTTTGGCGTGGCACAGCTCCGGTACGTACGATAAGGAGACGAAGACCGGCGGAAGGTAAATTGTATATCAAATGGAAGCTTTCATTTCCC
ATTAACAAATTTTTAAGTAACTATGCTGCGATGCGCTTCGAGCCGGAATCTCTTCACGGTGCCAACAACGGCTTGAATGTTGCTCGGGACTTGCTTGAGAAAGTGAAGGCAAAGTTCCCA
TGGATAAGCTACGGTGATCTCTGGACTCTTGCCGGCGTGTGCGCAGTTCAG
GTAAGCAATTCCTAATCAGGTTATTTTTGGTATCAATGATGGATCTTGTTTCATTGTAGGAAATGGGAG
GTCCGAAGATCCCGTGGAGAGCCGGTCGCATTGACGGCTTCTCTAAGGACGCGACTCCAGATGGCCGACTTCCGGATGCCAGCCAGGGCTCAGACCACGTTCGAAACATATTCTACCGAA
TGGG
GTATGTTCTAAACATATTTAACAATATTCATTTCTATAACTTTAGCTCCAGATTCAACGACCAGGAAATTGTTGCTTTGTTAGGTGCACATGCTCTGGGACGTTGCCATACCGATC
GCTCTGGATTTGAGGGTCCCTGGACGTTCTCACCAATCACATTCACCAACGATTTCTTCACTCTCCTTTTTAATGAGAA
GTGCGTATCTTGGCCTGTACATCATATCAGCTTGTTAATCT
GTGTAATTTCCAGGTGGATTTGGAGAAAATGGAGTGGTCCCAAGCAGCTACAGGACAAGAAGACTGGTTCTCTTATGATGCTGCCGACCGACTACGTTCTTGTTCAAGACAAGAACTTCA
AGAAATTCGCAAAGGCATATGCAGATAACCAGGATATTTTCTTCGAAGA
GTACGCCTTTTACATTCTCTGCATAACTATACCGCTTACCAGGATTTATAGTTTCTCGAAGGCATTTGCCA
AGCTTCTCGAACTCGGTGTTCCCGAGAGTCAATGGGTTGCTCAGGAGCCATGGCTGTTGAAGAACACGGATGAGCAAAAGTCCCAATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCATGCTCGCTGCCCTCCGCACCCCCGCCCGTCGGACCGCATTTGCCGCAGCGCCTCGCGCTGCTATGCGCACTAGCATGCGCGTTCGTCCCTCCTTACGCAAATACGCAACTGAG
TCCGCCCCGAACCCCGAGCCCAAGTCGGGTAGCAATGCCTGGCTCTATGGCTCAGTTGGTGCTGCTGCACTCGTATCCGTTGGATACTACGTCTACGCCACATCGGATGTGGGCAGAGAG
GCGGGCACTGCGGCCAAGTCTGCTGGCCAGGCTGTGAAGGTCAAGGCCAACTTCGTCCCGACGAAGGAAGATTACCAGAAG
GTTTACAACGAGATTGTCAACATTTTGGAGGAAAATGGC
GAATATGATG
ATGGTTCTTACGGTCCCGTCCTCGTTCGTTTGGCGTGGCACAGCTCCGGTACGTACGATAAGGAGACGAAGACCGGCGGAAGTAACTATGCTGCGATGCGCTTCGAGCCG
GAATCTCTTCACGGTGCCAACAACGGCTTGAATGTTGCTCGGGACTTGCTTGAGAAAGTGAAGGCAAAGTTCCCATGGATAAGCTACGGTGATCTCTGGACTCTTGCCGGCGTGTGCGCA
GTTCAG
GAAATGGGAGGTCCGAAGATCCCGTGGAGAGCCGGTCGCATTGACGGCTTCTCTAAGGACGCGACTCCAGATGGCCGACTTCCGGATGCCAGCCAGGGCTCAGACCACGTTCGA
AACATATTCTACCGAATGGG
CTCCAGATTCAACGACCAGGAAATTGTTGCTTTGTTAGGTGCACATGCTCTGGGACGTTGCCATACCGATCGCTCTGGATTTGAGGGTCCCTGGACGTTC
TCACCAATCACATTCACCAACGATTTCTTCACTCTCCTTTTTAATGAGAA
GTGGATTTGGAGAAAATGGAGTGGTCCCAAGCAGCTACAGGACAAGAAGACTGGTTCTCTTATGATGCTG
CCGACCGACTACGTTCTTGTTCAAGACAAGAACTTCAAGAAATTCGCAAAGGCATATGCAGATAACCAGGATATTTTCTTCGAAGA
TTTCTCGAAGGCATTTGCCAAGCTTCTCGAACTC
GGTGTTCCCGAGAGTCAATGGGTTGCTCAGGAGCCATGGCTGTTGAAGAACACGGATGAGCAAAAGTCCCAATAG

Retrieve as FASTA