Entry information : TvCcP (CCP1)
Entry ID 10686
Creation 2012-03-05 (Christophe Dunand)
Last sequence changes 2012-03-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-27 (Catherine Mathe (Scipio))
Peroxidase information: TvCcP (CCP1)
Name (synonym) TvCcP (CCP1)
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Trametes
Organism Trametes versicolor (Coriolus versicolor )    [TaxId: 5325 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TvCcP
start..stop
S start..stop
ParcCcP01 645 0 1..380 1..379
DsCcP 617 0 25..380 23..374
CsuCcP 593 0 1..379 1..377
CuniCcP01 587 0 5..380 2..375
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2690070..2690387 318 N° 2 2690455..2690509 55 N° 3 2690579..2690660 82 N° 4 2690799..2691069 271
N° 5 2691127..2691443 317 N° 6 2691500..2691599 100  
join(2690070..2690387,2690455..2690509,2690579..2690660,2690799..2691069,2691127 ..2691443,2691500..2691599)


exon

Literature and cross-references TvCcP (CCP1)
DNA ref. JGI genome:   scaffold_2 (2690070..2691599)
Cluster/Prediction ref. JGI gene:   26601
Protein sequence: TvCcP (CCP1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   381
PWM (Da):   %s   41654.87  
PI (pH):   %s   8.85
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFAALRASARRAGAAAPAARASRTALRNPAFRKFSTEVPPPPTPKKSSNAALLGALGAAAVGGVGFWIYTSSSDSAREAGTAVKSGVQAAKVAANYVPTQEDYQKVYNRVAEILDSAGDKGYDDGSYGPVLVRLAWHASGTYDKDSNTGGSNYATMRFEPEAKHGANNGLNVARELLEPVKQEFPWISYGDLWTLAGVASIQEMGGPKVPWRPGRIDGFSTQCTPDGRLPDAAQGADHIRNIFYRMGFNDQEIVALSGAHALGRCHTDRSGFEGPWTFSPTSVTNEYYKLLLNEKWAWKKWDGPKQLEDKKTRSLMMLPTDYALVQDKSFKKWTKAYADDEQLWFKDFSSVVARLFELGVPTQQFVSSEPWILKSSDEK*

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTCGCAGCACTCAGAGCATCTGCACGCCGCGCTGGCGCCGCCGCTCCTGCAGCCCGTGCGTCCCGCACCGCCCTGCGCAACCCCGCCTTCCGTAAGTTCTCTACGGAGGTTCCC
CCTCCCCCCACCCCGAAGAAGAGCAGCAACGCAGCTCTTCTTGGTGCTCTCGGCGCCGCCGCTGTGGGTGGTGTCGGCTTCTGGATCTACACCTCCAGCTCCGACTCTGCGAGGGAAGCC
GGCACCGCGGTGAAGTCGGGCGTCCAGGCTGCCAAGGTTGCCGCCAACTACGTCCCCACTCAGGAGGACTACCAGAAG
GTCGGTCGTTGCTCCGTGCAGCCTAGGCATGTAGAGGGCGTT
GGCGTTGACGTTGAGCTGCTCGCAGGTGTACAACCGCGTTGCCGAAATTCTTGACTCCGCCGGTGATAAGGGGTACGACGGTACGTGTCCTTCCGGAGGCGTGTGAGCAGCGCGGTTCAG
GGCTCACGTATCCCGTCCCCGCCCTGCAGATGGCTCCTACGGTCCCGTCCTCGTCCGTCTGGCATGGCATGCGTCGGGTACCTACGATAAGGACTCGAACACTGGCGGCAGGTGAGTTTC
GTTCTGTCGAGGCTTCCGGGCGATAAACCGGTATATCGGAGCGCTCGCTGATGCTCTTCTTCCCCGTTATTGCGTATCTGTCTCCGCTCGTCAACCATCATGTCTCCGTCGATGCGTGTG
ACCGTAAAGCAACTATGCCACTATGCGCTTCGAGCCTGAGGCCAAGCACGGCGCGAACAACGGTCTGAACGTTGCTCGCGAGCTGCTTGAGCCCGTCAAGCAGGAATTCCCGTGGATTTC
CTACGGCGATCTCTGGACGCTGGCTGGTGTGGCCAGTATCCAGGAGATGGGCGGCCCCAAGGTCCCCTGGCGTCCGGGCCGCATTGACGGCTTCTCCACTCAGTGCACCCCCGACGGCCG
TCTGCCTGACGCCGCACAGGGTGCCGACCACATCCGCAAT
GTAAGCGCTGTATTTGCATCCGTCAAGGCAGACGAACTAACGCCGGGTGTCCCATAGATCTTCTACCGCATGGGCTTCAA
CGACCAGGAGATCGTTGCGCTGAGCGGTGCGCACGCGCTCGGGCGCTGCCACACGGACCGCTCCGGATTTGAGGGTCCGTGGACGTTCTCGCCGACGAGCGTAACGAACGAGTACTACAA
GCTGCTCCTTAATGAGAAGTGGGCGTGGAAGAAGTGGGACGGCCCGAAGCAGCTCGAGGACAAGAAGACGCGCTCGCTGATGATGCTACCGACCGACTACGCGCTCGTCCAGGACAAGTC
GTTCAAGAAGTGGACGAAGGCGTACGCGGACGACGAGCAGCTGTGGTTCAAGGA
GTACGTGTACACACCTTCGCTTGTGGTGTCAGCGGTACTGACTGTTGTGTGTACAGCTTCTCGTCC
GTGGTCGCGCGGCTCTTCGAGCTCGGCGTGCCGACGCAGCAGTTCGTCTCTTCTGAGCCCTGGATTCTCAAGAGCTCGGACGAGAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTCGCAGCACTCAGAGCATCTGCACGCCGCGCTGGCGCCGCCGCTCCTGCAGCCCGTGCGTCCCGCACCGCCCTGCGCAACCCCGCCTTCCGTAAGTTCTCTACGGAGGTTCCC
CCTCCCCCCACCCCGAAGAAGAGCAGCAACGCAGCTCTTCTTGGTGCTCTCGGCGCCGCCGCTGTGGGTGGTGTCGGCTTCTGGATCTACACCTCCAGCTCCGACTCTGCGAGGGAAGCC
GGCACCGCGGTGAAGTCGGGCGTCCAGGCTGCCAAGGTTGCCGCCAACTACGTCCCCACTCAGGAGGACTACCAGAAG
GTGTACAACCGCGTTGCCGAAATTCTTGACTCCGCCGGTGAT
AAGGGGTACGACG
ATGGCTCCTACGGTCCCGTCCTCGTCCGTCTGGCATGGCATGCGTCGGGTACCTACGATAAGGACTCGAACACTGGCGGCAGCAACTATGCCACTATGCGCTTCGAG
CCTGAGGCCAAGCACGGCGCGAACAACGGTCTGAACGTTGCTCGCGAGCTGCTTGAGCCCGTCAAGCAGGAATTCCCGTGGATTTCCTACGGCGATCTCTGGACGCTGGCTGGTGTGGCC
AGTATCCAGGAGATGGGCGGCCCCAAGGTCCCCTGGCGTCCGGGCCGCATTGACGGCTTCTCCACTCAGTGCACCCCCGACGGCCGTCTGCCTGACGCCGCACAGGGTGCCGACCACATC
CGCAAT
ATCTTCTACCGCATGGGCTTCAACGACCAGGAGATCGTTGCGCTGAGCGGTGCGCACGCGCTCGGGCGCTGCCACACGGACCGCTCCGGATTTGAGGGTCCGTGGACGTTCTCG
CCGACGAGCGTAACGAACGAGTACTACAAGCTGCTCCTTAATGAGAAGTGGGCGTGGAAGAAGTGGGACGGCCCGAAGCAGCTCGAGGACAAGAAGACGCGCTCGCTGATGATGCTACCG
ACCGACTACGCGCTCGTCCAGGACAAGTCGTTCAAGAAGTGGACGAAGGCGTACGCGGACGACGAGCAGCTGTGGTTCAAGGA
CTTCTCGTCCGTGGTCGCGCGGCTCTTCGAGCTCGGC
GTGCCGACGCAGCAGTTCGTCTCTTCTGAGCCCTGGATTCTCAAGAGCTCGGACGAGAAGTAA

Retrieve as FASTA