Entry information : ShirAPx-CcP (Stehi-CCP-APX / ShirAPx-CcP)
Entry ID 10688
Creation 2012-03-05 (Christophe Dunand)
Last sequence changes 2012-03-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: ShirAPx-CcP (Stehi-CCP-APX / ShirAPx-CcP)
Name (synonym) ShirAPx-CcP (Stehi-CCP-APX / ShirAPx-CcP)
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Stereaceae Stereum
Organism Stereum hirsutum    [TaxId: 40492 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ShirAPx-CcP
start..stop
S start..stop
HanAPx-CcP04 570 0 27..530 26..525
PmelaAPx-CcP02_FUNGUS 472 7e-163 1..502 1..503
CgeoAPx-CcP02 467 3e-161 21..533 25..516
MphAPx-CcP 461 8e-159 1..522 1..521
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3298880..3299117 238 N° 2 3299184..3299330 147 N° 3 3299404..3299652 249 N° 4 3299750..3299831 82
N° 5 3299892..3300011 120 N° 6 3300088..3300268 181 N° 7 3300330..3300370 41 N° 8 3300441..3300726 286
N° 9 3300803..3301060 258  
join(3298880..3299117,3299184..3299330,3299404..3299652,3299750..3299831,3299892 ..3300011,3300088..3300268,3300330..3300370,3300441..3300726,3300803..3301060)


exon

Literature and cross-references ShirAPx-CcP (Stehi-CCP-APX / ShirAPx-CcP)
DNA ref. JGI genome:   scaffold_3 (3298880..3301060)
Cluster/Prediction ref. JGI gene:   137882
Protein sequence: ShirAPx-CcP (Stehi-CCP-APX / ShirAPx-CcP)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   534 (513)
PWM (Da):   %s   56147.78 (54079.7)  
PI (pH):   %s   4.25 (4.25) Peptide Signal:   %s   cut: 21 range:21-533
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFIALTLLTAASLVSTCSAETVLTWPSPLYDSLEHLLVDTSGANDAGFKAAITPCTNYVSGSQLLGRETAAQWIRVAFHDFATADVEKGTGGIDASIGFETLRPENSGSAMNDSLAFFAPYVNAHTSMSDLIALSVVMAVGACSGPQIPLRGGRIDATEGGEFGVPEPESSIEDTLSRLQLAGFDQSDSIALTACGHTMGSVHNGGFPQVVPPSAITPNNTGGGVHFDATPAAFDINVVNEYLTWTGQRGGPLVTTDNVTVRSDLRLYTSDNNATMKTLSQSSGYFRNACTDVFERMINTVPAEVNLSEVISPLSIKPVNVTVEVLWNGTMSISGFIRLLITDSSEPLNTITISFASRNTSGTGVHPIEAAYSGPQDIGSSIFGTTYYYSFNTYFDSFTGISTFGTSANSVTAQYAVDDTVLWLPHFSSLGTEVDSIGKVAVNITAAVLTSWAADSVEAIFSAPTPQPGTLSPRIETSYLPLQLIGTAGEYSVYSGLTQLDSSTSNRTTVDIVAKGKQGTVVNEFRKLAGLS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTCATTGCCCTGACCCTCCTCACTGCTGCTTCTCTCGTATCGACGTGCTCTGCAGAGACAGTCCTCACTTGGCCTTCCCCGCTCTATGACTCGCTGGAGCACCTCTTGGTTGAT
ACGAGCGGCGCCAACGACGCAGGATTCAAAGCTGCTATAACTCCCTGTACGAACTATGTCAGTGGCAGCCAGTTATTGGGAAGAGAGACTGCTGCTCAATGGATAAGGGTGGCATTTC
GT
GCGTTTTATCTCGTCTCATGTCTCAAGTCGTCTGTATACCCCTTTCTCAAGACATTTATCGCAGATGATTTCGCGACGGCAGATGTGGAGAAGGGGACCGGTGGGATCGATGCCTCCATT
GGCTTCGAAACTTTGCGTCCGGAGAATAGCGGCTCTGCTATGAACGACTCCCTTGCCTTCTTTGCACCTTATGTGAATGCGCATACATCGA
GTGAGTGCCCTCTTGTTATTTCTACTTAC
GATCGTCTCAATACTGACTACAATGATAATGACGACCTCTACAGTGTCAGACCTCATAGCTCTCAGTGTCGTGATGGCAGTCGGTGCCTGCAGCGGTCCCCAAATCCCACTTCGAGGCGG
GCGCATCGATGCTACAGAGGGTGGTGAATTCGGAGTCCCCGAGCCAGAGTCGAGCATCGAGGACACTCTGAGTCGTCTTCAACTGGCCGGGTTTGATCAAAGTGACTCTATTGCGTTGAC
CGCGTGTGGGCATACGATGGGTTCGGTCCATAATGGCGGTTTTCCGCAAGTCG
GTAAGCGTTTGCTTGCTTTTGCGGGCCTTAGGTGGAACGAGTTGAATGGACAGCTGATTAGGATGGT
CTCGTTCCTGGTAATTTTTGTTTGAGATAGTTCCTCCGAGCGCGATAACACCGAACAATACTGGAGGTGGTGTCCATTTTGACGCCACACCTGCAGCTTTTGATATAAACGTGTGAGCGC
CCTGTCTTCTCGCTATTCCTTCCGAAATACTTGCTTATGAACAATGCAACAGAGTCAATGAGTATCTTACCTGGACAGGCCAGCGAGGTGGACCTCTCGTTACCACAGACAACGTAACAG
TCCGCTCCGACCTACGCCTCTACACATCAGACAACAACGCCACCATGAAAAC
GTACGTTCATCCTTCTCTCGTCTCTGCCAACGCGACAAACGATTTCCCACTCAAAGCCTCTCCGCTTC
ATTAACAGCCTATCACAGTCCTCAGGATATTTCCGGAATGCCTGCACCGACGTGTTCGAACGGATGATCAATACCGTTCCGGCCGAAGTCAACCTGAGCGAAGTGATATCGCCATTATCT
ATCAAACCTGTGAATGTTACGGTGGAAGTGCTGTGGAACGGGACGATGTCGATATCCGGATTCATCCGC
GTAGGTTTACCTTCCTCACCATCACTACCCTCGTTCCGCCTCACAGCTATT
TCTCGTTCAGCTTTTGATCACAGATAGCAGTGAACCACTCAACACCATCACGTACGTGAGGACAGATATAGCGGTCATTCATTCATTCTCTCCTCTCGTGCTCAACAACCGTCTCATTCA
GCATATCTTTCGCTTCACGAAACACGAGTGGAACCGGCGTCCATCCGATCGAAGCGGCTTACAGTGGCCCACAAGACATAGGATCCAGCATTTTTGGGACGACATACTACTATTCGTTTA
ACACCTATTTTGACTCGTTCACTGGAATTTCCACCTTCGGCACAAGTGCCAACTCGGTCACCGCACAGTACGCTGTGGACGACACCGTGCTTTGGCTCCCTCACTTCTCGTCCTTGGGCA
CCGAGGTTGACTCCATTGGGAAGGTGGCCGTAAATATCACCGCTGCA
GTAAGCCCTCTGCCTATCGTGCTCGTTTGATAAGTCGAGGCTGATTTTTCTTCGATGTCCTCGTTTTGGAATG
CAGGTATTGACTTCATGGGCCGCGGACAGCGTCGAAGCGATCTTCTCAGCTCCGACTCCTCAACCGGGCACACTTTCTCCGCGTATCGAAACATCATACCTCCCCCTGCAACTTATAGGA
ACGGCTGGAGAGTACAGTGTGTACTCTGGTTTGACGCAGTTAGATTCGTCTACCTCCAACAGGACAACGGTTGACATTGTGGCAAAGGGGAAGCAGGGGACTGTTGTCAACGAGTTCAGA
AAATTAGCTGGTCTTTCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTCATTGCCCTGACCCTCCTCACTGCTGCTTCTCTCGTATCGACGTGCTCTGCAGAGACAGTCCTCACTTGGCCTTCCCCGCTCTATGACTCGCTGGAGCACCTCTTGGTTGAT
ACGAGCGGCGCCAACGACGCAGGATTCAAAGCTGCTATAACTCCCTGTACGAACTATGTCAGTGGCAGCCAGTTATTGGGAAGAGAGACTGCTGCTCAATGGATAAGGGTGGCATTTC
AT
GATTTCGCGACGGCAGATGTGGAGAAGGGGACCGGTGGGATCGATGCCTCCATTGGCTTCGAAACTTTGCGTCCGGAGAATAGCGGCTCTGCTATGAACGACTCCCTTGCCTTCTTTGCA
CCTTATGTGAATGCGCATACATCGA
TGTCAGACCTCATAGCTCTCAGTGTCGTGATGGCAGTCGGTGCCTGCAGCGGTCCCCAAATCCCACTTCGAGGCGGGCGCATCGATGCTACAGAG
GGTGGTGAATTCGGAGTCCCCGAGCCAGAGTCGAGCATCGAGGACACTCTGAGTCGTCTTCAACTGGCCGGGTTTGATCAAAGTGACTCTATTGCGTTGACCGCGTGTGGGCATACGATG
GGTTCGGTCCATAATGGCGGTTTTCCGCAAGTCG
TTCCTCCGAGCGCGATAACACCGAACAATACTGGAGGTGGTGTCCATTTTGACGCCACACCTGCAGCTTTTGATATAAACGTAGTC
AATGAGTATCTTACCTGGACAGGCCAGCGAGGTGGACCTCTCGTTACCACAGACAACGTAACAGTCCGCTCCGACCTACGCCTCTACACATCAGACAACAACGCCACCATGAAAAC
CCTA
TCACAGTCCTCAGGATATTTCCGGAATGCCTGCACCGACGTGTTCGAACGGATGATCAATACCGTTCCGGCCGAAGTCAACCTGAGCGAAGTGATATCGCCATTATCTATCAAACCTGTG
AATGTTACGGTGGAAGTGCTGTGGAACGGGACGATGTCGATATCCGGATTCATCCGC
CTTTTGATCACAGATAGCAGTGAACCACTCAACACCATCACCATATCTTTCGCTTCACGAAAC
ACGAGTGGAACCGGCGTCCATCCGATCGAAGCGGCTTACAGTGGCCCACAAGACATAGGATCCAGCATTTTTGGGACGACATACTACTATTCGTTTAACACCTATTTTGACTCGTTCACT
GGAATTTCCACCTTCGGCACAAGTGCCAACTCGGTCACCGCACAGTACGCTGTGGACGACACCGTGCTTTGGCTCCCTCACTTCTCGTCCTTGGGCACCGAGGTTGACTCCATTGGGAAG
GTGGCCGTAAATATCACCGCTGCA
GTATTGACTTCATGGGCCGCGGACAGCGTCGAAGCGATCTTCTCAGCTCCGACTCCTCAACCGGGCACACTTTCTCCGCGTATCGAAACATCATAC
CTCCCCCTGCAACTTATAGGAACGGCTGGAGAGTACAGTGTGTACTCTGGTTTGACGCAGTTAGATTCGTCTACCTCCAACAGGACAACGGTTGACATTGTGGCAAAGGGGAAGCAGGGG
ACTGTTGTCAACGAGTTCAGAAAATTAGCTGGTCTTTCATGA

Retrieve as FASTA