Entry information : PoCcP_PC15
Entry ID 10694
Creation 2012-03-05 (Christophe Dunand)
Last sequence changes 2012-03-05 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: PoCcP_PC15
Name PoCcP_PC15
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Pleurotaceae Pleurotus
Organism Pleurotus ostreatus (Oyster mushroom)    [TaxId: 5322 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PoCcP_PC15
start..stop
S start..stop
PoCcP_PC9 776 0 1..375 1..375
AthiCcP01 585 0 1..372 1..370
SnivCcP01 579 0 6..372 4..366
SlacCcP01 577 0 6..373 6..372
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 734170..734466 297 N° 2 734528..734576 49 N° 3 734629..734710 82 N° 4 734770..734923 154
N° 5 734974..735090 117 N° 6 735142..735158 17 N° 7 735209..735352 144 N° 8 735405..735476 72
N° 9 735528..735611 84 N° 10 735668..735782 115  
join(734170..734466,734528..734576,734629..734710,734770..734923,734974..735090, 735142..735158,735209..735352,735405..735476,735528..735611,735668..735782)


exon

Literature and cross-references PoCcP_PC15
DNA ref. JGI genome:   scaffold_05 (734170..735782)
Cluster/Prediction ref. JGI gene:   1096819
Protein sequence: PoCcP_PC15
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   377
PWM (Da):   %s   41954.92  
PI (pH):   %s   8.15
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLSTFLRAPARRAVFTASIPKAPVRRQAAFRRFSTAPPSEPAKSNTALYAALGAATVAGLGYWFYASDAGREAVTAAKSGVQSGKAALNFTPTKEDYQKVYNKIVEFVEDAGDYDDGSYGPVLVRLAWHSSGTYDKETKTGGSNYATMRFEPESTHGANAGLNVARDLMEKVKQEFPWISYGDLWTLGGVCAIEMSGPKIPWRPGRIDGFAANATPDGRLPDATQGADHLRNIFYRMGFNDQEIVALSGAHALGRCHADRSGFEGPWTFSPTTLTNDYYKLLFDEKWVWKKWNGPKQLEDKKTRSLMMLPTDYVLITDKSYKKFARAYADNQDLFFKDFSAAVSRLFELGVPESQWVTSEPWEMKTKEEQEAEKK

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCTCGACGTTCCTCCGTGCGCCAGCTCGCAGAGCAGTATTTACTGCCTCGATCCCAAAAGCACCGGTGCGCAGGCAGGCAGCTTTCCGCAGATTCTCGACCGCACCGCCCAGCGAG
CCAGCGAAGTCAAATACTGCTTTGTACGCTGCTTTGGGCGCCGCGACCGTTGCTGGCCTCGGCTATTGGTTCTACGCCTCCGATGCTGGCCGCGAGGCTGTTACGGCTGCAAAATCTGGC
GTTCAGTCTGGCAAGGCAGCCTTGAACTTTACCCCTACGAAGGAGGACTATCAAAAG
GTCGGTGAAAGGTTGGGAATATGGGTTAGGAGGTGTCTGACGTGTCGCGACGGTGGTATAGGT
GTACAACAAAATCGTCGAATTTGTTGAGGACGCCGGCGATTACGACG
GTAAACGTTATCGCTCGCTTGTTGTATTTACTCACACTGATAAGCATCACAGACGGTTCGTATGGCCCTGTTC
TCGTCCGCCTCGCATGGCACAGCTCGGGTACTTATGATAAAGAGACAAAAACCGGCGGCAG
GTGAGAATCCACTTGAAAGCAGCGATGCACGGCCTCTGATCACGACACGGGATTCATAG

CAACTATGCCACCATGCGCTTCGAGCCCGAGTCTACTCACGGCGCCAACGCCGGGCTTAACGTAGCCCGTGATCTCATGGAGAAGGTCAAGCAGGAATTCCCGTGGATTAGCTACGGTGA
CTTGTGGACTCTTGGTGGTGTTTGCGCAATTCAG
GTGAGTTCTCATCCGACCGCCCCTCTGCGGCATAGTAAATCCCTCGGCAGGAAATGTCTGGTCCCAAGATTCCCTGGCGTCCTGGG
CGTATCGACGGCTTCGCTGCCAACGCTACTCCTGACGGTCGCCTCCCGGATGCTACACAAGGTGCTGACCATCTCCGCAAC
GTGAGTTATGCTCATGTTTTGTACTCGGACAACATTCTG
ATTTACCCCCAGATCTTCTACCGTATGGGGTGTGTCCATCGGCTTTGCAGGTTCTCCCATTCATGCTAAATTAATTTAGATTCAATGACCAAGAAATTGTCGCTCTCTCTGGTGCCCATG
CTCTTGGACGCTGCCACGCCGACCGCTCCGGATTCGAGGGCCCCTGGACATTCTCGCCTACTACTCTGACCAATGATTACTACAAGCTTCTGTTCGACGAGAA
GTATGTGAATAATTTTC
CATCATCAACGACTTCTTACTGATTGATCTACTAGATGGGTATGGAAGAAGTGGAACGGCCCTAAACAGCTCGAGGATAAGAAGACACGTTCTTTGATGATGCTTCCGTAATGCCAGTTG
TTGATCTCGAAGTTTTTTCTACTAACGCCGCACTACAGCACGGATTATGTTCTCATCACCGACAAGAGCTACAAGAAATTCGCTAGGGCCTACGCTGATAACCAGGACCTATTCTTCAAG
GA
GTACGTACCTCTCATCTATATCTATCTGTCAACATCTGACCTGACCGTTACTCCAGCTTCTCTGCTGCTGTCTCTAGGCTCTTCGAACTTGGTGTTCCTGAGTCTCAGTGGGTGACTT
CTGAGCCCTGGGAGATGAAGACCAAGGAGGAGCAAGAGGCTGAGAAGAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCTCGACGTTCCTCCGTGCGCCAGCTCGCAGAGCAGTATTTACTGCCTCGATCCCAAAAGCACCGGTGCGCAGGCAGGCAGCTTTCCGCAGATTCTCGACCGCACCGCCCAGCGAG
CCAGCGAAGTCAAATACTGCTTTGTACGCTGCTTTGGGCGCCGCGACCGTTGCTGGCCTCGGCTATTGGTTCTACGCCTCCGATGCTGGCCGCGAGGCTGTTACGGCTGCAAAATCTGGC
GTTCAGTCTGGCAAGGCAGCCTTGAACTTTACCCCTACGAAGGAGGACTATCAAAAG
GTGTACAACAAAATCGTCGAATTTGTTGAGGACGCCGGCGATTACGACGACGGTTCGTATGGC
CCTGTTCTCGTCCGCCTCGCATGGCACAGCTCGGGTACTTATGATAAAGAGACAAAAACCGGCGGCAG
CAACTATGCCACCATGCGCTTCGAGCCCGAGTCTACTCACGGCGCCAACGCC
GGGCTTAACGTAGCCCGTGATCTCATGGAGAAGGTCAAGCAGGAATTCCCGTGGATTAGCTACGGTGACTTGTGGACTCTTGGTGGTGTTTGCGCAATTCAG
GAAATGTCTGGTCCCAAG
ATTCCCTGGCGTCCTGGGCGTATCGACGGCTTCGCTGCCAACGCTACTCCTGACGGTCGCCTCCCGGATGCTACACAAGGTGCTGACCATCTCCGCAAC
ATCTTCTACCGTATGGGATTC
AATGACCAAGAAATTGTCGCTCTCTCTGGTGCCCATGCTCTTGGACGCTGCCACGCCGACCGCTCCGGATTCGAGGGCCCCTGGACATTCTCGCCTACTACTCTGACCAATGATTACTAC
AAGCTTCTGTTCGACGAGAA
ATGGGTATGGAAGAAGTGGAACGGCCCTAAACAGCTCGAGGATAAGAAGACACGTTCTTTGATGATGCTTCCCACGGATTATGTTCTCATCACCGACAAG
AGCTACAAGAAATTCGCTAGGGCCTACGCTGATAACCAGGACCTATTCTTCAAGGA
CTTCTCTGCTGCTGTCTCTAGGCTCTTCGAACTTGGTGTTCCTGAGTCTCAGTGGGTGACTTCT
GAGCCCTGGGAGATGAAGACCAAGGAGGAGCAAGAGGCTGAGAAGAAGTAG

Retrieve as FASTA