Entry information : PoCcP_PC9
Entry ID 10695
Creation 2012-03-05 (Christophe Dunand)
Last sequence changes 2012-03-05 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: PoCcP_PC9
Name PoCcP_PC9
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Pleurotaceae Pleurotus
Organism Pleurotus ostreatus (Oyster mushroom)    [TaxId: 5322 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PoCcP_PC9
start..stop
S start..stop
PoCcP_PC15 776 0 1..375 1..375
AthiCcP01 586 0 1..372 1..370
SlacCcP01 579 0 6..373 6..372
SnivCcP01 577 0 6..372 4..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 585074..585370 297 N° 2 584967..585015 49 N° 3 584833..584914 82 N° 4 584620..584773 154
N° 5 584453..584569 117 N° 6 584384..584400 17 N° 7 584190..584333 144 N° 8 584066..584137 72
N° 9 583931..584014 84 N° 10 583762..583870 109  
complement(join(583762..583870,583931..584014,584066..584137,584190..584333,5843 84..584400,584453..584569,584620..584773,584833..584914,584967..585015,585074..5 85370))


exon

Literature and cross-references PoCcP_PC9
DNA ref. JGI genome:   scaffold_3 (585370..583762)
Cluster/Prediction ref. JGI gene:   77045
Protein sequence: PoCcP_PC9
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   376
PWM (Da):   %s   41854.86  
PI (pH):   %s   7.6
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLSTFLRAPARRAVFTASIPKAPVRRQAAFRRFSTAPPSEPAKSNTALYAALGAATVAGLGYWFYASDAGREAVTAAKSGVQSGKVALNFTPTKEDYQKVYNKIVEFVEDAGDYDDGSYGPVLVRLAWHSSGTYDKETKTGGSNYATMRFEPESTHGANAGLNVARDLMEKVKQEFPWISYGDLWTLGGVCAIEMSGPKIPWRPGRIDGFAANATPDGRLPDATQGADHLRNIFYRMGFNDQEIVALSGAHALGRCHADRSGFEGPWTFSPTTLTNDYYKLLFDEKWVWKKWNGPKQLEDKKTRSLMMLPTDYVLITDKSYKKFARAYADNQDLFFKDFSAAVSRLFELGVPESQWVTSEPWEMKTKEEQEAE

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCTCGACGTTCCTCCGTGCGCCAGCTCGCAGAGCAGTATTTACCGCCTCGATCCCAAAAGCACCGGTGCGCAGGCAGGCTGCTTTCCGCAGATTCTCGACCGCACCGCCCAGCGAA
CCAGCGAAGTCAAATACTGCTTTGTACGCTGCTTTGGGCGCCGCGACCGTTGCTGGTCTCGGTTATTGGTTCTACGCCTCCGATGCTGGCCGCGAGGCTGTTACGGCTGCAAAATCTGGC
GTTCAGTCCGGCAAGGTGGCCTTGAACTTTACCCCTACGAAAGAGGATTATCAAAAG
GTCGGTGAAAGGTTGGGAATATGGGTTAGGAGGTGTCTGACCCTCCGACGGTGGATAGGTGTA
CAACAAAATTGTCGAATTTGTTGAGGACGCCGGCGATTACGACG
GTAAACGTTATCGCTCGCTTGTTGTATTTACTCACACTGATAAGCATCGCAGACGGTTCGTATGGCCCTGTTCTCG
TCCGCCTCGCATGGCACAGCTCGGGTACTTATGATAAAGAGACAAAAACCGGCGGCAG
GTGAGAATCCATTTGAAAGCAGCGATGCGCGGCCTCTGATCACGACACGGGATTCATAGCAA
CTATGCCACCATGCGCTTCGAGCCCGAGTCTACTCACGGCGCCAACGCCGGGCTTAATGTAGCCCGTGATCTCATGGAGAAGGTTAAGCAGGAATTCCCGTGGATTAGTTACGGTGACTT
GTGGACTCTTGGTGGTGTTTGCGCAATTCAG
GTGAGTTCTCATCCGACCGCCCCTCTGCGGCATAGTAAATCCCTCGGCAGGAAATGTCTGGTCCCAAGATTCCCTGGCGTCCTGGGCGT
ATCGACGGCTTCGCTGCCAACGCTACTCCTGACGGTCGCCTCCCGGATGCTACGCAAGGTGCTGACCATCTCCGCAAC
GTGAGTTATGCTCGTGTCTTGTACTCGTACAACATTCTGATT
CACCCCCCAGATCTTCTACCGTATGGGGTGTGTCCATCGGCTTTGCATGTTCTCCCATTCATGCTAAATTAATTTAGATTCAATGACCAAGAAATTGTCGCTCTCTCTGGTGCCCACGCT
CTTGGACGCTGCCACGCCGACCGCTCCGGATTCGAGGGCCCCTGGACATTCTCGCCTACTACTCTGACCAATGATTACTACAAGCTTCTGTTCGACGAGAA
GTATGTGCATAATTTTCCA
TCATCAACGACTTATTACTGATTGATCTACTAGATGGGTATGGAAGAAGTGGAACGGCCCTAAACAGCTCGAGGATAAGAAGACACGTTCTTTGATGATGCTTCCGTAATGCCAGTTGTT
GATCTCGAAGTTTTTTCTACTAACGCCGCACTACAGCACGGATTATGTTCTCATCACCGACAAGAGCTACAAGAAATTCGCTAGGGCCTACGCTGATAACCAGGACCTATTCTTCAAGGA
GTACGTACCTCTCATCAATCTCTATCTATCTGTCAACATCTGACCTGACCGTTACTCCAGCTTCTCCGCTGCTGTCTCTAGGCTCTTCGAACTTGGTGTCCCTGAGTCTCAGTGGGTGAC
TTCTGAGCCCTGGGAGATGAAGACCAAGGAGGAGCAAGAGGCTGAGAAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCTCGACGTTCCTCCGTGCGCCAGCTCGCAGAGCAGTATTTACCGCCTCGATCCCAAAAGCACCGGTGCGCAGGCAGGCTGCTTTCCGCAGATTCTCGACCGCACCGCCCAGCGAA
CCAGCGAAGTCAAATACTGCTTTGTACGCTGCTTTGGGCGCCGCGACCGTTGCTGGTCTCGGTTATTGGTTCTACGCCTCCGATGCTGGCCGCGAGGCTGTTACGGCTGCAAAATCTGGC
GTTCAGTCCGGCAAGGTGGCCTTGAACTTTACCCCTACGAAAGAGGATTATCAAAAG
GTGTACAACAAAATTGTCGAATTTGTTGAGGACGCCGGCGATTACGACGACGGTTCGTATGGC
CCTGTTCTCGTCCGCCTCGCATGGCACAGCTCGGGTACTTATGATAAAGAGACAAAAACCGGCGGCAG
CAACTATGCCACCATGCGCTTCGAGCCCGAGTCTACTCACGGCGCCAACGCC
GGGCTTAATGTAGCCCGTGATCTCATGGAGAAGGTTAAGCAGGAATTCCCGTGGATTAGTTACGGTGACTTGTGGACTCTTGGTGGTGTTTGCGCAATTCAG
GAAATGTCTGGTCCCAAG
ATTCCCTGGCGTCCTGGGCGTATCGACGGCTTCGCTGCCAACGCTACTCCTGACGGTCGCCTCCCGGATGCTACGCAAGGTGCTGACCATCTCCGCAAC
ATCTTCTACCGTATGGGATTC
AATGACCAAGAAATTGTCGCTCTCTCTGGTGCCCACGCTCTTGGACGCTGCCACGCCGACCGCTCCGGATTCGAGGGCCCCTGGACATTCTCGCCTACTACTCTGACCAATGATTACTAC
AAGCTTCTGTTCGACGAGAA
ATGGGTATGGAAGAAGTGGAACGGCCCTAAACAGCTCGAGGATAAGAAGACACGTTCTTTGATGATGCTTCCCACGGATTATGTTCTCATCACCGACAAG
AGCTACAAGAAATTCGCTAGGGCCTACGCTGATAACCAGGACCTATTCTTCAAGGA
CTTCTCCGCTGCTGTCTCTAGGCTCTTCGAACTTGGTGTCCCTGAGTCTCAGTGGGTGACTTCT
GAGCCCTGGGAGATGAAGACCAAGGAGGAGCAAGAGGCTGAGAAG

Retrieve as FASTA