Entry information : GsppAPx-CcP
Entry ID 10698
Creation 2012-03-05 (Christophe Dunand)
Last sequence changes 2012-03-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-22 (Catherine Mathe (Scipio))
Peroxidase information: GsppAPx-CcP
Name GsppAPx-CcP
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Fungi/Metazoa; Fungi; Basidiomycota; Basidiomycota
Organism Ganoderma sp. 10597 SS1    [TaxId: 767862 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GsppAPx-CcP
start..stop
S start..stop
DsAPx-CcP 819 0 1..532 1..534
ParcAPx-CcP02 768 0 13..540 13..541
ParcAPx-CcP01 647 0 8..540 7..539
AdelAPx-CcP 405 1e-136 7..511 5..491
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 978484..978705 222 N° 2 978770..978856 87 N° 3 978909..978975 67 N° 4 979031..979076 46
N° 5 979139..979414 276 N° 6 979466..979579 114 N° 7 979644..979824 181 N° 8 979892..980254 363
N° 9 980313..980603 291  
join(978484..978705,978770..978856,978909..978975,979031..979076,979139..979414, 979466..979579,979644..979824,979892..980254,980313..980603)


exon

Literature and cross-references GsppAPx-CcP
DNA ref. JGI genome:   scaffold_4 (978484..980603)
Cluster/Prediction ref. JGI gene:   127620
Protein sequence: GsppAPx-CcP
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   549 (528)
PWM (Da):   %s   58116.19 (56055.1)  
PI (pH):   %s   4.41 (4.37) Peptide Signal:   %s   cut: 21 range:21-548
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLGISRLSSILLLAACASAYTWPNPQLDELESLVYDQHGFNERGILAGALAPCNAFNFGSTVNRSNAADWIRTAYHDMATHNVEDGTGGLDASIQFEQDRPENAGDGFFNSLRHLQLGISRYVGVADFIALGAKTAVEQCGGPHLPFRGGRVDATEAGVPGVPQPQESLDSHTAAFARQGFNQTEMITLIACGHSFGGVQNSAFPQIVPLPDGVSDVSQTFDSTPFTFDNNVAAEYIHGTTNNPLVVGHNDTTNSDKCIFGSDGNATMSGFAADPASFRLACQSLLTRMLDTVPKTVQLTEVIEPLPVKPQAIALTYMDDGTFHLTGQARFWNMVYSASRSVKLLWADRDGKTDPAYASVLGTNGQMAATALYDGTVAVQWYNVGPLSTNYTVIDAATGISKVWFEVDEGDGSAPTTQDQGGAGFAVQDVVMVANSSCIVQSTGNAHIQIAVRADKTPSRVYVEYDLFNGATGDGAAWITVNTTDAQPEATGQKRAGEAYTFWTADLSPSAVARSLNQRVNVAADIDGAKVSTSSFGPFAFGVWASC

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCATTGGGCATCTCGCGCCTCTCGAGCATCCTCCTACTCGCGGCCTGCGCCTCTGCGTACACCTGGCCGAACCCTCAGCTCGACGAGCTCGAGAGCTTGGTGTACGACCAGCATGGC
TTCAACGAGCGCGGCATCCTCGCGGGCGCACTTGCCCCTTGCAACGCGTTCAACTTCGGCAGCACAGTCAACCGGTCGAACGCAGCCGACTGGATTCGGACG
GTGCGTGCCACGTCGGCT
CGTTTTTGCATGCCTGGAGATGGAGACTGACATGGCTCGAGTGCAGGCCTACCATGACATGGCTACTCACAATGTAGAAGATGGCACTGGTGGTCTTGATGCCTCGATCCAGTTCGAGCA
GGACAGGCCCGAG
GTAAATAAGTGGATAAGATCCTCGCGAACCATCCTGCTGACTTGTGGTGTAGAACGCTGGGGACGGTTTCTTTAACTCCCTGAGACACCTCCAGTTGGGTATCAGTC
GCTATGTGGGAG
GTAGATTTTCAGATGTGCGGTCAATGCCTGAATCTATGGCTTACGAACTGTGCAGTTGCGGACTTCATCGCCCTTGGAGCAAAGACTGCCGTCGAGCAATGGTAGGTC
CATTCCGGTCTTCGTCCATTGACCAGTCTTCCGCAGCTGATAAAATACACTATAGCGGTGGTCCCCATCTCCCCTTCCGCGGCGGGCGTGTGGATGCCACTGAGGCCGGGGTCCCCGGTG
TTCCCCAGCCGCAAGAGAGTCTTGATAGCCACACCGCTGCATTTGCCCGTCAGGGCTTCAACCAGACCGAGATGATCACTCTCATCGCATGTGGACACTCCTTCGGTGGCGTACAGAATA
GCGCATTCCCGCAGATTGTGCCGCTTCCAGACGGGGTTAGCGACGTGTCCCAGACGTTTGACAGCACGCCGTTCACTTTCGACAACAATGT
GTATGTGTTGCCCGTCCGTTGATGGCGTT
CATCTACTGACGGTTAGCGCAGTGCGGCCGAGTACATCCACGGCACGACGAACAACCCTCTCGTGGTGGGCCACAACGATACCACCAACTCTGACAAGTGCATCTTTGGGAGTGACGGCA
ATGCGACCATGAGCGG
GTGCGTACAACTTGTAATGTCGCTGCATACTGGTTGGGATTGAGCGGAGAGGTTTGGCGACAAGGTTCGCCGCAGACCCTGCTTCATTTCGGTTGGCGTGCCAG
TCGCTGCTCACCCGAATGCTGGACACCGTCCCGAAGACTGTACAGCTCACCGAGGTCATCGAGCCGCTCCCCGTGAAGCCACAGGCCATTGCACTCACGTACATGGATGATGGTACCTTC
CATCTCACAGGACAAGCTCGC
GTACGTGCTCTACGAATAACAGTCCATTGTAACAGCTCCGTGAACTCGCCGTCCTTGAATCGCACAGTTCTGGAACATGGTCTATAGCGCCTCACGCTC
CGTCAAGCTCCTCTGGGCCGACCGCGACGGGAAGACCGACCCCGCATACGCCAGCGTCCTGGGCACCAACGGGCAGATGGCTGCGACTGCGCTCTACGATGGCACGGTCGCCGTCCAGTG
GTACAACGTCGGCCCGCTCTCGACTAACTACACGGTCATCGACGCCGCGACCGGGATCTCGAAGGTCTGGTTCGAGGTCGACGAGGGCGATGGGAGCGCCCCGACAACGCAGGACCAGGG
CGGCGCGGGCTTCGCCGTGCAGGACGTGGTCATGGTCGCCAATTCGTCGTGCATCGTGCAGTCCACTGGCAATGCCCACATTCAGATTGCC
GTGAGTTCCGACTGCGCTCGTAATCGGGT
TGAGACTAAACAACCCTTGGGGGGTACAGGTGCGTGCAGACAAGACGCCGTCGCGGGTATACGTGGAGTACGACCTTTTCAACGGGGCGACCGGCGATGGCGCCGCGTGGATCACCGTCA
ACACGACCGACGCGCAACCGGAGGCTACTGGCCAGAAGAGGGCTGGGGAGGCATACACATTCTGGACGGCGGACCTGTCGCCCTCGGCGGTAGCACGTTCGCTTAACCAGAGGGTCAACG
TCGCCGCGGACATCGATGGCGCGAAGGTCTCGACGTCGAGCTTCGGGCCGTTCGCCTTCGGCGTGTGGGCAAGCTGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCATTGGGCATCTCGCGCCTCTCGAGCATCCTCCTACTCGCGGCCTGCGCCTCTGCGTACACCTGGCCGAACCCTCAGCTCGACGAGCTCGAGAGCTTGGTGTACGACCAGCATGGC
TTCAACGAGCGCGGCATCCTCGCGGGCGCACTTGCCCCTTGCAACGCGTTCAACTTCGGCAGCACAGTCAACCGGTCGAACGCAGCCGACTGGATTCGGACG
GCCTACCATGACATGGCT
ACTCACAATGTAGAAGATGGCACTGGTGGTCTTGATGCCTCGATCCAGTTCGAGCAGGACAGGCCCGAG
AACGCTGGGGACGGTTTCTTTAACTCCCTGAGACACCTCCAGTTGGGTATC
AGTCGCTATGTGGGAG
TTGCGGACTTCATCGCCCTTGGAGCAAAGACTGCCGTCGAGCAATGCGGTGGTCCCCATCTCCCCTTCCGCGGCGGGCGTGTGGATGCCACTGAGGCCGGGGTC
CCCGGTGTTCCCCAGCCGCAAGAGAGTCTTGATAGCCACACCGCTGCATTTGCCCGTCAGGGCTTCAACCAGACCGAGATGATCACTCTCATCGCATGTGGACACTCCTTCGGTGGCGTA
CAGAATAGCGCATTCCCGCAGATTGTGCCGCTTCCAGACGGGGTTAGCGACGTGTCCCAGACGTTTGACAGCACGCCGTTCACTTTCGACAACAATGT
TGCGGCCGAGTACATCCACGGC
ACGACGAACAACCCTCTCGTGGTGGGCCACAACGATACCACCAACTCTGACAAGTGCATCTTTGGGAGTGACGGCAATGCGACCATGAGCGG
GTTCGCCGCAGACCCTGCTTCATTTCGG
TTGGCGTGCCAGTCGCTGCTCACCCGAATGCTGGACACCGTCCCGAAGACTGTACAGCTCACCGAGGTCATCGAGCCGCTCCCCGTGAAGCCACAGGCCATTGCACTCACGTACATGGAT
GATGGTACCTTCCATCTCACAGGACAAGCTCGC
TTCTGGAACATGGTCTATAGCGCCTCACGCTCCGTCAAGCTCCTCTGGGCCGACCGCGACGGGAAGACCGACCCCGCATACGCCAGC
GTCCTGGGCACCAACGGGCAGATGGCTGCGACTGCGCTCTACGATGGCACGGTCGCCGTCCAGTGGTACAACGTCGGCCCGCTCTCGACTAACTACACGGTCATCGACGCCGCGACCGGG
ATCTCGAAGGTCTGGTTCGAGGTCGACGAGGGCGATGGGAGCGCCCCGACAACGCAGGACCAGGGCGGCGCGGGCTTCGCCGTGCAGGACGTGGTCATGGTCGCCAATTCGTCGTGCATC
GTGCAGTCCACTGGCAATGCCCACATTCAGATTGCC
GTGCGTGCAGACAAGACGCCGTCGCGGGTATACGTGGAGTACGACCTTTTCAACGGGGCGACCGGCGATGGCGCCGCGTGGATC
ACCGTCAACACGACCGACGCGCAACCGGAGGCTACTGGCCAGAAGAGGGCTGGGGAGGCATACACATTCTGGACGGCGGACCTGTCGCCCTCGGCGGTAGCACGTTCGCTTAACCAGAGG
GTCAACGTCGCCGCGGACATCGATGGCGCGAAGGTCTCGACGTCGAGCTTCGGGCCGTTCGCCTTCGGCGTGTGGGCAAGCTGCTGA

Retrieve as FASTA