Entry information : GmarDyPrx02
Entry ID 10704
Creation 2012-03-06 (Christophe Dunand)
Last sequence changes 2012-03-06 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-19 (Catherine Mathe (Scipio))
Peroxidase information: GmarDyPrx02
Name GmarDyPrx02
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Galerina
Organism Galerina marginata    [TaxId: 109633 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmarDyPrx02
start..stop
S start..stop
GmarDyPrx03 784 0 29..499 27..501
GmarDyPrx04 723 0 27..499 25..510
HcyDyPrx01 655 0 22..499 18..501
AthiDyPrx01 580 0 29..499 5..471
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1086450..1086565 116 N° 2 1086622..1086853 232 N° 3 1086906..1087210 305 N° 4 1087277..1087575 299
N° 5 1087635..1087695 61 N° 6 1087748..1088013 266 N° 7 1088062..1088116 55 N° 8 1088177..1088342 166
join(1086450..1086565,1086622..1086853,1086906..1087210,1087277..1087575,1087635 ..1087695,1087748..1088013,1088062..1088116,1088177..1088342)


exon

Literature and cross-references GmarDyPrx02
DNA ref. JGI genome:   scaffold_9 (1086450..1088342)
Cluster/Prediction ref. JGI gene:   65104
Protein sequence: GmarDyPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   500
PWM (Da):   %s   55027.34  
PI (pH):   %s   6.89
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSAPQQPLPPIVPAPPPTIPSNPPPPVVLKLDNIQGDVLSGLPKKTETLFFFQITDPIKFRQELRTFIPLIKTVAGVLKDRDAIDKHKKCHGSSLQPHLIPMVGVNIAFSHFGFELQIDDSKLLDTAFLSGQKLDAGANLGDKGSGSGTNFIPDWEEPFKQEIHGVILLAGDSHATVDKKLAEIKHIFRVGEHSASIKEITSVRGDSRPGDQSAHEHFGYLDGVSNPQIIGFDQNPPPGPAPVRPGAIVMGEDGDLNQADRADWMKDGSFLVFRYLFQKVPEFDDFVHSNRLKGPGMTDKEGTDLLGARLVGRWKGAPIDITPFQDDPDLGADPQRNNNFHFSGEVNFQKLCPFAAHIRKTLPRADLESLRISIEKNRIMRRGIQFGPEVTRAEKSAKKTFHGRGLLFACYQSSITNGFQFIQNWVNNATFPFGEKTQEVPGLDPIISQGTDRKLTGIDPNNPSTELKLDDQWVIPRGGEYFFTPSIKGLSDTIAT

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAGCACCCCAACAACCATTGCCCCCCATTGTCCCTGCTCCTCCTCCCACTATTCCATCCAACCCGCCTCCACCGGTTGTCCTCAAGCTTGACAACATCCAGGGAGATGTCTTGTTC
GTTTATTTCTTATTTACGACTCTCTGTCTGCAATACTCATCAACCTTAATAGGAGTGGTCTTCCAAAGAAGACCGAAACATTGTTCTTCTTCCAGATTACTGACCCGATCAAGTTCAGAC
AGGAGTTGCGCACCTTCATCCCTCTTATCAAGACCGTTGCCGGGGTGCTCAAAGACCGTGATGCCATCGACAAACACAAGAAGTGTCACGGAAGTAGTCTTCAACCCCACCTGATCCCGA
TGGTGGGGGTCAATATCGCTTTTTCTCATTTCGGATTTGAGAAG
GTATACATTCTTCACTGAATATTATGAGGGTTGCTGACGTCATCCTGTTAAGCTTCAAATCGACGACTCGAAATTG
CTTGACACCGCTTTCCTGAGTGGCCAGAAGCTTGACGCAGGTGCTAACCTTGGAGACAAGGGTTCTGGATCTGGAACGAACTTCATTCCCGATTGGGAGGAACCATTCAAGCAAGAAATT
CATGGCGTTATCCTTCTTGCCGGTGATAGCCATGCTACGGTCGACAAGAAACTGGCCGAGATCAAACACATATTTCGAGTTGGAGAGCATTCGGCATCTATCAAGGAAATCACTTCTGTG
CGTGGTGATTCGCGTCCAGGAGATCAATCTGCACACGAGCA
GTGAGTAATAAACGATTCAGCTCCTCAGTAATAATTCTAATACATTCTAATTTGGGTAAACGATAGTTTCGGTTACCTA
GACGGTGTATCCAACCCCCAGATCATTGGCTTTGACCAGAACCCTCCTCCAGGACCTGCTCCGGTCCGCCCTGGTGCTATTGTTATGGGCGAAGACGGCGACCTCAATCAAGCTGATCGC
GCTGACTGGATGAAGGATGGAAGTTTCCTAGTCTTCCGATACCTCTTCCAGAAGGTACCAGAATTCGACGACTTTGTCCACAGCAACAGGCTCAAAGGGCCAGGAATGACCGATAAAGAA
GGCACGGACCTCCTCGGAGCAAGGCTCGTTGGTCGTTGGAAGAGCG
GTACGCGGGCATAATAGATTTTTCTGCCACATGTTCCCAACGACATTCATCGCCTACAGGTGCCCCCATCGATA
TCACGCCTTTCCAAGACGACCCAGACCTTGGTGCTGATCCCCAGAG
GTGTGCAATACTTTTGACTTCCACGTACACATTTTGGCTGACCAGGTCACAGAAACAACAATTTCCACTTTTCC
GGTGAAGTCAACTTCCAGAAACTCTGCCCCTTCGCAGCCCACATTCGCAAGACGCTTCCCCGTGCTGATTTAGAGAGTCTCAGAATTTCAATTGAAAAGAACCGGATTATGCGTCGTGGA
ATTCAATTTGGGCCTGAAGTCACCAGGGCTGAGAAGTCCGCCAAGAAGACATTCCATGGGCGTGGACTGTTGTTTGCCTGCTATCAAAGCAGCATCACCAATGGCTTCCAGTTCATCCAG
AAGA
GTAAGTGCGCGTCATTTGAATGGGCCTGCCTTTTCTGACACCTCGTAGACTGGGTGAATAATGCAACCTTCCCTTTTGGCGAGAAAACACAAGAGGTCCCAGGGTTCGTCTGATCC
TGTTGAAGATCTGCTTTCTCAATCAGGCTAATTCCCCTCTTTGATAGACTGGACCCCATTATCAGTCAAGGCACAGACAGGAAATTGACCGGCATCGACCCAAATAACCCATCTACTGAA
TTGAAGCTCGACGACCAATGGGTTATTCCCCGTGGCGGAGAGTACTTCTTCACTCCATCTATCAAGGGCTTGAGCGATACGATCGCCACATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAGCACCCCAACAACCATTGCCCCCCATTGTCCCTGCTCCTCCTCCCACTATTCCATCCAACCCGCCTCCACCGGTTGTCCTCAAGCTTGACAACATCCAGGGAGATGTCTTGAGT
GGTCTTCCAAAGAAGACCGAAACATTGTTCTTCTTCCAGATTACTGACCCGATCAAGTTCAGACAGGAGTTGCGCACCTTCATCCCTCTTATCAAGACCGTTGCCGGGGTGCTCAAAGAC
CGTGATGCCATCGACAAACACAAGAAGTGTCACGGAAGTAGTCTTCAACCCCACCTGATCCCGATGGTGGGGGTCAATATCGCTTTTTCTCATTTCGGATTTGAGAAG
CTTCAAATCGAC
GACTCGAAATTGCTTGACACCGCTTTCCTGAGTGGCCAGAAGCTTGACGCAGGTGCTAACCTTGGAGACAAGGGTTCTGGATCTGGAACGAACTTCATTCCCGATTGGGAGGAACCATTC
AAGCAAGAAATTCATGGCGTTATCCTTCTTGCCGGTGATAGCCATGCTACGGTCGACAAGAAACTGGCCGAGATCAAACACATATTTCGAGTTGGAGAGCATTCGGCATCTATCAAGGAA
ATCACTTCTGTGCGTGGTGATTCGCGTCCAGGAGATCAATCTGCACACGAGCA
TTTCGGTTACCTAGACGGTGTATCCAACCCCCAGATCATTGGCTTTGACCAGAACCCTCCTCCAGGA
CCTGCTCCGGTCCGCCCTGGTGCTATTGTTATGGGCGAAGACGGCGACCTCAATCAAGCTGATCGCGCTGACTGGATGAAGGATGGAAGTTTCCTAGTCTTCCGATACCTCTTCCAGAAG
GTACCAGAATTCGACGACTTTGTCCACAGCAACAGGCTCAAAGGGCCAGGAATGACCGATAAAGAAGGCACGGACCTCCTCGGAGCAAGGCTCGTTGGTCGTTGGAAGAGCG
GTGCCCCC
ATCGATATCACGCCTTTCCAAGACGACCCAGACCTTGGTGCTGATCCCCAGAG
AAACAACAATTTCCACTTTTCCGGTGAAGTCAACTTCCAGAAACTCTGCCCCTTCGCAGCCCACATT
CGCAAGACGCTTCCCCGTGCTGATTTAGAGAGTCTCAGAATTTCAATTGAAAAGAACCGGATTATGCGTCGTGGAATTCAATTTGGGCCTGAAGTCACCAGGGCTGAGAAGTCCGCCAAG
AAGACATTCCATGGGCGTGGACTGTTGTTTGCCTGCTATCAAAGCAGCATCACCAATGGCTTCCAGTTCATCCAGAAGA
ACTGGGTGAATAATGCAACCTTCCCTTTTGGCGAGAAAACA
CAAGAGGTCCCAGG
ACTGGACCCCATTATCAGTCAAGGCACAGACAGGAAATTGACCGGCATCGACCCAAATAACCCATCTACTGAATTGAAGCTCGACGACCAATGGGTTATTCCCCGT
GGCGGAGAGTACTTCTTCACTCCATCTATCAAGGGCTTGAGCGATACGATCGCCACATAA

Retrieve as FASTA