Entry information : GmarDyPrx04
Entry ID 10706
Creation 2012-03-06 (Christophe Dunand)
Last sequence changes 2012-03-06 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-19 (Catherine Mathe (Scipio))
Peroxidase information: GmarDyPrx04
Name GmarDyPrx04
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Galerina
Organism Galerina marginata    [TaxId: 109633 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmarDyPrx04
start..stop
S start..stop
GmarDyPrx03 840 0 1..510 1..501
GmarDyPrx02 700 0 25..510 27..499
HcyDyPrx01 627 0 20..510 18..501
AthiDyPrx01 552 0 27..510 5..471
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 595901..596010 110 N° 2 596067..596301 235 N° 3 596355..596659 305 N° 4 596723..597025 303
N° 5 597107..597465 359 N° 6 597533..597587 55 N° 7 597642..597807 166  
join(595901..596010,596067..596301,596355..596659,596723..597025,597107..597465, 597533..597587,597642..597807)


exon

Literature and cross-references GmarDyPrx04
DNA ref. JGI genome:   scaffold_26 (595901..597807)
Cluster/Prediction ref. JGI gene:   143869
Protein sequence: GmarDyPrx04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   511
PWM (Da):   %s   55937.16  
PI (pH):   %s   7.74
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATQQTLPPVTLPPPTPPNSAPTPVALKLENIQGDILSGLPKKTETLYFFQITDAVKFREDLKKIIPLVKSVAQVLKDREEIEKHKRGHGLHGFRSILIPLVGVNISFSHFGFKLGIDDTKLVDTAFLNGQRFEAGANLGDKGTGSGQDFVPDWEEPFKKEIHGVIILAGDSHASVDKKLQEIKLIFDVGGRTSSIAEITSVQGDARPGDQSAHEHFGYLDGVSNPAIIGFDTNPPPGPAPIRAGAIILGQDGDNSISERAPWMVDGSFLVFRYLFQKVPEFDDFVFRNRLKGPGMSDKEGADLLGARLIGRWKSGAMTQNSELIRKGKKLVESLNIPWLTLPPCRNNNFHFSAERNFQKLCPFAAHIRKTLPRADLESLGLGISLETTRIMRRGIQFGPEVTKTEKLAKKTFHGRGLIFACYQSSIISGFQFLQGRINNATFPFAENTPEVPGVDPILGQGEDRKLSGTDPNNPAAELNLDDEWVIPRGGEYFFSPSIQGLTNTIAA

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACTCAGCAAACCCTGCCTCCCGTCACTCTCCCCCCGCCTACTCCCCCCAACTCAGCTCCTACGCCTGTCGCCCTTAAACTCGAGAATATCCAAGGTGACATCTTGTGAGTGTAT
CGTCATTTTGCCATTTATCACCCAGTTAATGAATTCGTAATCGTAGGAGTGGCCTTCCCAAGAAGACAGAGACTTTGTATTTCTTCCAAATCACAGATGCTGTCAAGTTCCGCGAGGACC
TCAAGAAAATCATACCCCTGGTCAAGAGCGTCGCTCAAGTGCTCAAAGACAGAGAGGAGATAGAGAAGCATAAACGTGGCCATGGACTTCATGGCTTTAGATCTATCCTCATCCCATTGG
TCGGCGTCAACATTTCCTTCTCCCACTTCGGTTTCAAGAAG
GTACTTTTCGACTCAATATAAATCCGTCATATTATTCACTCGAGCTTGTGTAGCTCGGAATTGATGACACCAAGTTGGT
TGACACTGCCTTCCTCAACGGGCAGCGTTTCGAGGCTGGCGCCAACCTCGGCGATAAAGGTACTGGCTCTGGACAAGACTTCGTCCCAGATTGGGAAGAACCTTTCAAGAAGGAGATCCA
TGGTGTCATTATCCTCGCTGGTGATAGCCACGCCAGCGTCGACAAGAAACTTCAAGAGATCAAGCTCATCTTTGACGTTGGCGGTCGCACATCGTCTATTGCAGAGATCACCTCCGTTCA
GGGCGACGCTCGCCCTGGAGACCAATCAGCCCATGAGCA
GTAAGTCGACAATGTTTCATCTGGGTGTTCGACTACCTTCTGATATCCCAAATCGCGGAACAGCTTTGGATACCTCGATGG
CGTGTCTAACCCTGCCATCATAGGATTCGACACCAATCCTCCACCAGGACCGGCTCCAATTCGTGCAGGTGCAATCATCCTCGGCCAGGATGGCGACAACAGCATATCTGAGCGTGCGCC
ATGGATGGTCGACGGAAGTTTCCTCGTTTTCAGATACCTCTTCCAGAAAGTGCCAGAGTTCGACGACTTTGTGTTCAGGAATCGACTCAAGGGCCCAGGAATGTCTGACAAGGAAGGTGC
TGACCTTCTTGGAGCACGTCTCATCGGTCGCTGGAAAAGCGGTGC
GTGATTCCCATATTCTTTTTGGTTGGTTTATAGACTTATTTTCTTTTTGAAGGTGCTCCTGTTGACCTCTCTCCA
TTCCAGGATGACCCAGAACTCGGAGCTGATCCGCAAAGGCAAGAAATTAGTCGAATCTTTGAATATACCTTGGCTGACTTTACCGCCTTGTAGGAATAACAATTTCCACTTCTCCGCTGA
GCGTAACTTCCAGAAACTTTGCCCATTTGCGGCGCATATCCGCAAGACTCTTCCCCGTGCCGACCTCGAGAGTCTTGGGCTTGGGATCTCACTTGAGACGACTCGTATCATGCGCCGAGG
GATCCAATTTGGTCCAGAAGTCACCAAGACCGAGAAACTGGCGAAGAAGACATTCCATGGTCGTGGATTGATCTTCGCCTGCTACCAGAGCAGCATCATCAGTGGCTTCCAATTCCTCCA
GAGCG
GTGAGCGGTAATTTGTCGCGGCGGTGTGTGTGATAGTCCTCTAACGCGGCTTGCTTCTGTTCTGCAGGCCGGATCAACAATGCTACGTTCCCATTTGCAGAAAACACACCAGAAG
TTCCTGG
GTGGGCAGTTATCTTTCCTAGTTCGCCGAAACTGCTGAACGTAGGATAATACAGGGTCGACCCGATTCTCGGTCAAGGTGAAGACCGTAAATTGTCTGGCACTGACCCCAACA
ACCCTGCTGCTGAGCTTAATCTTGATGACGAATGGGTAATCCCTCGTGGCGGAGAATACTTCTTCAGCCCGTCTATCCAGGGGTTGACCAACACAATCGCCGCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACTCAGCAAACCCTGCCTCCCGTCACTCTCCCCCCGCCTACTCCCCCCAACTCAGCTCCTACGCCTGTCGCCCTTAAACTCGAGAATATCCAAGGTGACATCTTGAGTGGCCTT
CCCAAGAAGACAGAGACTTTGTATTTCTTCCAAATCACAGATGCTGTCAAGTTCCGCGAGGACCTCAAGAAAATCATACCCCTGGTCAAGAGCGTCGCTCAAGTGCTCAAAGACAGAGAG
GAGATAGAGAAGCATAAACGTGGCCATGGACTTCATGGCTTTAGATCTATCCTCATCCCATTGGTCGGCGTCAACATTTCCTTCTCCCACTTCGGTTTCAAGAAG
CTCGGAATTGATGAC
ACCAAGTTGGTTGACACTGCCTTCCTCAACGGGCAGCGTTTCGAGGCTGGCGCCAACCTCGGCGATAAAGGTACTGGCTCTGGACAAGACTTCGTCCCAGATTGGGAAGAACCTTTCAAG
AAGGAGATCCATGGTGTCATTATCCTCGCTGGTGATAGCCACGCCAGCGTCGACAAGAAACTTCAAGAGATCAAGCTCATCTTTGACGTTGGCGGTCGCACATCGTCTATTGCAGAGATC
ACCTCCGTTCAGGGCGACGCTCGCCCTGGAGACCAATCAGCCCATGAGCA
CTTTGGATACCTCGATGGCGTGTCTAACCCTGCCATCATAGGATTCGACACCAATCCTCCACCAGGACCG
GCTCCAATTCGTGCAGGTGCAATCATCCTCGGCCAGGATGGCGACAACAGCATATCTGAGCGTGCGCCATGGATGGTCGACGGAAGTTTCCTCGTTTTCAGATACCTCTTCCAGAAAGTG
CCAGAGTTCGACGACTTTGTGTTCAGGAATCGACTCAAGGGCCCAGGAATGTCTGACAAGGAAGGTGCTGACCTTCTTGGAGCACGTCTCATCGGTCGCTGGAAAAGCGGTGC
GATGACC
CAGAACTCGGAGCTGATCCGCAAAGGCAAGAAATTAGTCGAATCTTTGAATATACCTTGGCTGACTTTACCGCCTTGTAGGAATAACAATTTCCACTTCTCCGCTGAGCGTAACTTCCAG
AAACTTTGCCCATTTGCGGCGCATATCCGCAAGACTCTTCCCCGTGCCGACCTCGAGAGTCTTGGGCTTGGGATCTCACTTGAGACGACTCGTATCATGCGCCGAGGGATCCAATTTGGT
CCAGAAGTCACCAAGACCGAGAAACTGGCGAAGAAGACATTCCATGGTCGTGGATTGATCTTCGCCTGCTACCAGAGCAGCATCATCAGTGGCTTCCAATTCCTCCAGAGCG
GCCGGATC
AACAATGCTACGTTCCCATTTGCAGAAAACACACCAGAAGTTCCTGG
GGTCGACCCGATTCTCGGTCAAGGTGAAGACCGTAAATTGTCTGGCACTGACCCCAACAACCCTGCTGCTGAG
CTTAATCTTGATGACGAATGGGTAATCCCTCGTGGCGGAGAATACTTCTTCAGCCCGTCTATCCAGGGGTTGACCAACACAATCGCCGCATAA

Retrieve as FASTA