Entry information : RgraCcP02
Entry ID 10713
Creation 2012-03-07 (Christophe Dunand)
Last sequence changes 2012-03-07 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-20 (Catherine Mathe (Scipio))
Peroxidase information: RgraCcP02
Name RgraCcP02
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Rhodotorula
Organism Rhodotorula graminis    [TaxId: 29898 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RgraCcP02
start..stop
S start..stop
SrosCcP001 510 0 1..356 1..366
MvioCcP02 441 4e-156 1..353 1..339
CqueCcP02 422 2e-148 32..356 43..372
AteCcP02_NIH2624 420 1e-147 6..354 12..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1266044..1266350 307 N° 2 1266415..1266483 69 N° 3 1266550..1266689 140 N° 4 1266765..1266945 181
N° 5 1267015..1267095 81 N° 6 1267163..1267238 76 N° 7 1267310..1267453 144 N° 8 1267532..1267619 88
join(1266044..1266350,1266415..1266483,1266550..1266689,1266765..1266945,1267015 ..1267095,1267163..1267238,1267310..1267453,1267532..1267619)


exon

Literature and cross-references RgraCcP02
DNA ref. JGI genome:   scaffold_2 (1266044..1267619)
Cluster/Prediction ref. JGI gene:   48023
Protein sequence: RgraCcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362
PWM (Da):   %s   39645.57  
PI (pH):   %s   7.6
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFSSLLRATPRLAARAAPLQAARQSARRSYASAAPAPKAGGNGGLLFGLLGVGVVGGGLYLYARPDSDDARTVKDAASTKEVDYQKVYNAIAESLEDEKYDDGSYGPVLVRLAWHCSGTYDKNTGNGGSNGATMRFAPEANHGANAGLEHARNHLEKIKQKFPEITYSDLTLAGVCAIQEAGGPYIPWRAGRKDGDVDNCTPDGRLPDGDKGADHIRNIFYRMGMDDKEIVALSGAHALGRCHADRSGFDGPWQYSPTTFSNEYYRLLYDDKWQERKWQGPPQFENKSDKSLMMLRTDMALTTDKEFRKYSQKYAKDEQAFFSDFSKAFSKLIHLGVPTTQLSEAVPLKKTEDQAPATA

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTCTCGTCCCTCCTCCGCGCGACCCCTCGCCTCGCCGCCCGTGCGGCCCCGCTCCAGGCTGCTCGCCAGTCGGCTCGTCGCTCGTACGCCTCGGCGGCACCTGCGCCCAAGGCC
GGCGGCAACGGCGGCCTCCTGTTCGGCCTCCTCGGCGTCGGCGTCGTCGGTGGCGGGCTCTACTTGTACGCTCGCCCGGACTCGGACGACGCCCGCACGGTCAAGGACGCCGCCAGCACC
AAGGAGGTCGACTACCAGAAGGTGTACAACGCGATCGCCGAGTCGCTCGAGGACGAGAAGTATGACG
GTGCGTCCCCCTTCTTCCTCCTCCTCCAGTCGAGGTCGCCCGACTGATTCGCT
CTCGCCTGCAGACGGCTCGTACGGCCCTGTCCTCGTTCGTCTCGCGTGGCACTGCTCGGGCACCTACGACAAGAACACGGGTGCGCTCAGCGTCCTCTTTCTCTCCCTCTCGAGTGATCG
CCCTGACTCTCCTCCCGGCGCAACAGGCAACGGCGGCTCGAACGGCGCGACGATGCGCTTCGCCCCCGAGGCCAACCACGGCGCCAACGCCGGTCTCGAGCATGCCCGCAACCACCTCGA
GAAGATCAAGCAGAAGTTCCCCGAGATCACGTACTCGGACCTCTGG
GTGCGCTCTCGCTCTCTCTCCCCTCGATCGTCGCCCACATCGAGGCTCCAGTCACTGACTCTGTGTCGCACACA
GACTCTCGCCGGCGTATGCGCCATCCAGGAGGCCGGCGGTCCTTACATCCCGTGGCGCGCCGGTCGCAAGGACGGCGACGTCGACAACTGCACGCCCGACGGCCGCCTTCCCGACGGCGA
CAAGGGCGCCGACCACATCCGCAACATCTTCTACCGCATGGGCATGGACGACAAGGAGATTG
GTCCATCCCGCCTCCTCGCAGCCCTCCCTGGAAGACCTCGTTCCTGACTTGTCTCTGC
CCCCCTCACAGTCGCTCTCTCGGGCGCACACGCTCTCGGCCGGTGCCACGCCGACCGCTCGGGCTTCGACGGCCCGTGGCAGTACTCGCCGAGTGCGTCCCGCAGTTCCTCTCCTCCTGG
CGCCCGACTCGAGAGCCTGACCCGCACCCTCTCCCGCAGCGACGTTCTCGAACGAGTACTACCGTCTCCTGTACGACGACAAGTGGCAGGAGCGCAAGTGGCAGGGCCCTCCTCAGTGCG
TCATCATGTCCCTGCCTCCCTCAGCTCGAACGAGCCCCTCCTGACGACGAGATTCGCCTCGCGCAGGTTCGAGAACAAGTCGGACAAGAGCCTCATGATGCTCCGCACCGACATGGCGCT
CACGACCGACAAGGAGTTCCGCAAGTACTCGCAGAAGTACGCCAAGGACGAGCAGGCCTTCTTCAGCGACTTCTCGAAGGCGTTCTCCAA
GTGCGTCCCTCTCGCGACCTCCTCTTCTGG
CCTCTCGCCGACCGCGCCCTGACTCGATTTCGCTTCTCCTCCCCACAGGCTCATCCACCTTGGCGTCCCGACGACCCAGCTCTCCGAGGCGGTCCCGCTCAAGAAGACGGAGGACCAGGC
GCCCGCGACGGCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTCTCGTCCCTCCTCCGCGCGACCCCTCGCCTCGCCGCCCGTGCGGCCCCGCTCCAGGCTGCTCGCCAGTCGGCTCGTCGCTCGTACGCCTCGGCGGCACCTGCGCCCAAGGCC
GGCGGCAACGGCGGCCTCCTGTTCGGCCTCCTCGGCGTCGGCGTCGTCGGTGGCGGGCTCTACTTGTACGCTCGCCCGGACTCGGACGACGCCCGCACGGTCAAGGACGCCGCCAGCACC
AAGGAGGTCGACTACCAGAAGGTGTACAACGCGATCGCCGAGTCGCTCGAGGACGAGAAGTATGACG
ACGGCTCGTACGGCCCTGTCCTCGTTCGTCTCGCGTGGCACTGCTCGGGCACC
TACGACAAGAACACGG
GCAACGGCGGCTCGAACGGCGCGACGATGCGCTTCGCCCCCGAGGCCAACCACGGCGCCAACGCCGGTCTCGAGCATGCCCGCAACCACCTCGAGAAGATCAAG
CAGAAGTTCCCCGAGATCACGTACTCGGACCTCTGG
ACTCTCGCCGGCGTATGCGCCATCCAGGAGGCCGGCGGTCCTTACATCCCGTGGCGCGCCGGTCGCAAGGACGGCGACGTCGAC
AACTGCACGCCCGACGGCCGCCTTCCCGACGGCGACAAGGGCGCCGACCACATCCGCAACATCTTCTACCGCATGGGCATGGACGACAAGGAGATTG
TCGCTCTCTCGGGCGCACACGCT
CTCGGCCGGTGCCACGCCGACCGCTCGGGCTTCGACGGCCCGTGGCAGTACTCGCCGA
CGACGTTCTCGAACGAGTACTACCGTCTCCTGTACGACGACAAGTGGCAGGAGCGCAAGTGG
CAGGGCCCTCCTCA
GTTCGAGAACAAGTCGGACAAGAGCCTCATGATGCTCCGCACCGACATGGCGCTCACGACCGACAAGGAGTTCCGCAAGTACTCGCAGAAGTACGCCAAGGACGAG
CAGGCCTTCTTCAGCGACTTCTCGAAGGCGTTCTCCAA
GCTCATCCACCTTGGCGTCCCGACGACCCAGCTCTCCGAGGCGGTCCCGCTCAAGAAGACGGAGGACCAGGCGCCCGCGACG
GCATGA

Retrieve as FASTA