Entry information : AalcAPx-CcP
Entry ID 10717
Creation 2012-03-08 (Christophe Dunand)
Last sequence changes 2012-03-08 (Christophe Dunand)
Sequence status complete
Reviewer Bruno Savelli
Last annotation changes 2015-12-16 (Bruno Savelli)
Peroxidase information: AalcAPx-CcP
Name AalcAPx-CcP
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Acremonium
Organism Acremonium alcalophilum    [TaxId: 398408 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AalcAPx-CcP
start..stop
S start..stop
VdaAPx-CcP01 1280 0 18..1037 15..1001
VdaAPx-CcP01 247 3e-68 574..927 674..1004
VdaAPx-CcP01 229 2e-62 691..1046 557..901
CgraAPx-CcP 1164 0 20..1040 20..1062
CgraAPx-CcP 94 8e-20 949..1042 866..958
StheAPx-CcP01 1066 0 1..1044 1..1056
CtheAPx-CcP01 1053 0 1..1038 1..1023
CtheAPx-CcP01 297 1e-85 694..1042 575..905
CtheAPx-CcP01 94 1e-19 592..678 941..1027
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3588511..3590183 1673 N° 2 3590283..3590863 581 N° 3 3590982..3591874 893  
join(3588511..3590183,3590283..3590863,3590982..3591874)


exon

Literature and cross-references AalcAPx-CcP
DNA ref. JGI genome:   scaffold_1 (3588511..3591874)
Cluster/Prediction ref. JGI gene:   2095766
Protein sequence: AalcAPx-CcP
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1049 (1028)
PWM (Da):   %s   111688.02 (109580.8)  
PI (pH):   %s   4.24 (4.21) Peptide Signal:   %s   cut: 21 range:21-1048
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRINGLALLALLGVVTRTGADPTWPSSIDEVEEIMFQIASTRSRKFADSVNPCTSQASGPGRHSAAEWLRTAFHDMATAHVFQGLGGLDASLQYELSNGENAGPGFATTLTWMAPYLSRRSSMADLIALGVYTSVRACGGPAVPIRAGRVDAVQGGSPGVPQPQNAIGIFRNQFQRMGFTSEEMVQLTACGHTLGGVHSSQFPDIVPPGTRPNDHAPFDSTVAVFDDRIVTDYLNGTTQNPLVVGPAVRINKHSDFKLFNSDANATISAMAGASTFREICRTVLQKMIDTVPPGVTLGEPITPYQVKPVQLQLTLSPQLGALDFTGYIRVRTTEMPLDTIEGLTINYRNRNGGSECGSGPCSFSLSVQGVGRGFDDTFAWFPIARQLPVSSGISSFTVTIRRTDGTSLLVDNNGNGYPLQDGVFLQRYQSCILATSGTTTLSAAVRNDRADLPVKAVISYKTPQTGSVVPALNNMTLELTKGPCVGSYTLFSASTTIPGGLSVEADFDIISGEGSSALVDYFKKANILGGACQSFPQTGSCTTPSSTSSSSETPASTDSIESNTASSTTSSTVPTESPHHREVIGEYRLVSCWTEGDGVRALSGASFAYDSMTLESCMANCTGFDYWGTEYGRECYCGNSLHGSTSSAPLDECDMACGGDDTQYCGSGNRLELYSTTATRSSSATSSAPTPTETPVRLPMVSDYAHVGCQTEGVGVRALQGPVLVDDDMTLDMCADFCSNYVYFGTEYGRCYCGNSLHSSSEPAPLEECGMTCAGNPFQYCGAGNRIELYRANTPSMVVPTPTDSSSWASTSSTQESSTTTMTEANPSHRPTVTPYMLVGCQTEGTGARALDGPSYASGTEMTLEACAEFCEGYRYFGTQYSAECFCGNRLHDTSLPAPLSECPMLCSGNPSEYCGGPDRLTLYRNDDIPSEEPDPEPRQPAFAGDDFVWLGCWTEPVAAGARALDGPTTASDDMSNEVCAEFCDGFAYFGTEYGRECFCGDEIHEGSEELDEEECNMRCSGARDEFCGNSNRLSVYARDEDADTES

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). Peroxidase domain fused to 4 WSC domains (putative carbohydrate binding domain)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGATCAATGGGCTTGCACTGTTGGCGCTGCTGGGTGTGGTCACCCGGACAGGCGCCGACCCGACCTGGCCTTCAAGCATCGACGAGGTAGAAGAGATCATGTTCCAGATCGCGAGC
ACCCGCTCCCGTAAGTTTGCCGACTCGGTGAACCCCTGCACCAGCCAGGCCTCTGGGCCCGGTCGACACAGCGCCGCCGAGTGGCTTCGAACCGCCTTCCATGACATGGCGACAGCCCAC
GTTTTCCAGGGACTAGGCGGCTTGGATGCGTCCTTGCAGTACGAATTAAGCAATGGCGAGAACGCGGGCCCGGGCTTTGCCACCACTCTGACGTGGATGGCTCCGTATTTGTCGAGGAGG
AGCTCCATGGCAGACCTCATCGCCTTGGGCGTCTACACATCCGTCCGCGCCTGCGGTGGTCCCGCCGTGCCCATTCGTGCCGGCCGCGTCGATGCCGTGCAGGGCGGCAGTCCGGGCGTC
CCGCAACCCCAGAACGCCATTGGCATTTTCCGTAACCAGTTTCAGCGTATGGGATTCACAAGCGAGGAGATGGTTCAGTTGACCGCGTGTGGCCATACCCTCGGCGGCGTCCATTCCTCC
CAGTTCCCGGACATTGTGCCTCCGGGCACGAGGCCCAACGACCACGCCCCTTTTGACTCGACCGTAGCCGTCTTTGACGACAGGATTGTCACCGACTACCTGAACGGCACGACGCAGAAT
CCCCTCGTCGTGGGTCCAGCAGTCCGCATCAACAAGCACTCCGACTTCAAGTTGTTCAACTCGGACGCCAATGCAACTATATCGGCCATGGCTGGTGCGTCCACCTTTCGCGAGATATGT
AGAACCGTCCTGCAGAAGATGATCGACACCGTCCCCCCAGGCGTCACCCTGGGCGAGCCCATCACCCCGTATCAGGTGAAACCCGTCCAGCTACAGCTCACGCTCTCTCCGCAACTCGGT
GCCTTGGACTTCACCGGCTACATCCGCGTTCGGACCACCGAAATGCCCCTCGACACGATCGAGGGGTTGACCATCAACTACAGGAACCGAAACGGAGGGTCCGAGTGCGGGTCAGGACCT
TGCAGCTTCTCCCTGTCGGTCCAGGGCGTTGGTAGAGGCTTCGACGACACCTTTGCCTGGTTCCCAATCGCGCGGCAGCTGCCCGTCTCCTCAGGTATCTCGTCCTTCACCGTCACCATT
CGCAGGACAGACGGGACCAGCCTCCTCGTGGATAACAACGGCAACGGCTATCCCTTGCAAGACGGCGTCTTCCTCCAACGGTATCAGAGCTGTATCCTGGCCACCTCCGGAACGACTACC
CTGAGCGCCGCCGTCCGGAACGACCGTGCGGATCTTCCCGTCAAGGCCGTCATCTCGTACAAGACCCCGCAGACGGGGAGCGTCGTGCCGGCTCTGAACAACATGACGCTGGAGCTAACC
AAGGGGCCCTGCGTCGGCAGCTATACTCTATTCTCGGCGAGCACCACGATCCCGGGAGGCCTCAGCGTTGAAGCAGATTTCGACATCATCAGCGGAGAGGGCTCGTCAGCTCTGGTGGAT
TATTTCAAGAAGGCCAACATCCTTGGGGGTGCGTGCCAGTCGTTCCCACAGACGGGATCATGCACGACTCCCTCGTCGACGTCATCGTCTTCGGAGACCCCGGCCAGCACCGA
GTCGTCG
TCCATCGTGTCGCGCGATATCAGCACTTCATCTGAGCTGCCGGCTTCGTCTGAGCCACCCAGTTCGGAGCCAACTTCGGCGCTGCCATCGAGCTCTATTGAATCCAACACGGCGTCTTCG
ACGACATCCAGCACGGTTCCGACAGAATCGCCCCACCACAGGGAGGTCATAGGCGAGTACAGGCTTGTCTCCTGCTGGACCGAGGGCGACGGGGTCCGCGCCCTCAGCGGTGCGAGCTTC
GCCTATGACTCGATGACCTTGGAGAGCTGCATGGCCAACTGCACCGGGTTTGACTATTGGGGTACCGAGTACGGCCGGGAATGCTACTGCGGCAACTCTCTTCACGGGTCCACATCATCT
GCGCCTCTTGACGAATGTGACATGGCTTGCGGCGGAGACGACACCCAGTATTGTGGCTCTGGTAACAGGCTGGAGCTCTACTCCACGACAGCAACCCGTAGCAGCAGCGCCACGAGCTCT
GCTCCGACTCCCACCGAAACACCGGTCCGCCTGCCGATGGTGTCCGACTATGCTCACGTCGGTTGCCAGACTGAGGGCGTCGGGGTTCGAGCTCTCCAGGGGCCGGTCCTAGTGGACGAT
GACATGACGCTCGATATGTGTGCCGACTTCTGCTCAAATTATGTTTACTTTGGAACCGAATACGGCCGAGAGT
GTTAGTGATGCCCAGCTCTCCTTCTGGCCTTCGTTTCCTTTTCCCCT
TTCGTTCTTTTCTCCCCTTATCCCAGGTAAAAGGAACTTGACACGTAAAGGTCCCGGCTAACCATGTGAAGGCTATTGTGGCAACTCCCTCCATTCATCTAGCGAGCCCGCACCGTTAGA
AGAGTGCGGAATGACATGCGCCGGAAACCCATTCCAATACTGCGGCGCCGGCAACCGAATCGAGCTGTACCGGGCGAACACCCCCTCCATGGTCGTACCCACGCCCACAGACAGCTCGTC
TTGGGCATCCACAAGTAGCACACAAGAGTCGTCGACGACAACCATGACAGAGGCAAACCCCTCCCACCGGCCCACCGTCACTCCGTACATGCTCGTCGGCTGCCAGACGGAAGGTACCGG
TGCCCGTGCCCTCGACGGCCCCTCATACGCCTCAGGCACGGAGATGACGCTGGAGGCCTGCGCCGAGTTCTGCGAAGGATACCGTTACTTCGGCACGCAATACAGCGCCGAGTGTTTCTG
CGGGAACAGGCTGCACGACACCTCGCTCCCAGCCCCGCTCTCCGAATGTCCCATGCTCTGCTCCGGCAACCCGTCCGAGTACTGCGGCGGACCGGACCGCCTCACGCTATACCGCAACGA
CGACATCCCTTCGGAGGAGCCCGACCCGGAACCACGCCAGCCGGCTTTCGCGGGCGACGACTTTGTCTGGCTGGGATGCTGGACAGAGCCGGTAGCAGCGGGCGCGCGGGCGTTGGACGG
GCCGACGACGGCGTCGGACGACATGTCCAACGAGGTTTGCGCAGAGTTTTGTGACGGGTTTGCGTACTTTGGTACCGAGTACGGCCGGGAGTGTTTCTGCGGCGACGAGATCCATGAGGG
ATCCGAGGAGTTGGATGAGGAGGAGTGCAATATGCGGTGCTCTGGCGCGAGGGACGAATTCTGTGGCAACTCGAATCGGCTTTCGGTATATGCACGAGATGAGGACGCGGATACGGAATC
GTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGATCAATGGGCTTGCACTGTTGGCGCTGCTGGGTGTGGTCACCCGGACAGGCGCCGACCCGACCTGGCCTTCAAGCATCGACGAGGTAGAAGAGATCATGTTCCAGATCGCGAGC
ACCCGCTCCCGTAAGTTTGCCGACTCGGTGAACCCCTGCACCAGCCAGGCCTCTGGGCCCGGTCGACACAGCGCCGCCGAGTGGCTTCGAACCGCCTTCCATGACATGGCGACAGCCCAC
GTTTTCCAGGGACTAGGCGGCTTGGATGCGTCCTTGCAGTACGAATTAAGCAATGGCGAGAACGCGGGCCCGGGCTTTGCCACCACTCTGACGTGGATGGCTCCGTATTTGTCGAGGAGG
AGCTCCATGGCAGACCTCATCGCCTTGGGCGTCTACACATCCGTCCGCGCCTGCGGTGGTCCCGCCGTGCCCATTCGTGCCGGCCGCGTCGATGCCGTGCAGGGCGGCAGTCCGGGCGTC
CCGCAACCCCAGAACGCCATTGGCATTTTCCGTAACCAGTTTCAGCGTATGGGATTCACAAGCGAGGAGATGGTTCAGTTGACCGCGTGTGGCCATACCCTCGGCGGCGTCCATTCCTCC
CAGTTCCCGGACATTGTGCCTCCGGGCACGAGGCCCAACGACCACGCCCCTTTTGACTCGACCGTAGCCGTCTTTGACGACAGGATTGTCACCGACTACCTGAACGGCACGACGCAGAAT
CCCCTCGTCGTGGGTCCAGCAGTCCGCATCAACAAGCACTCCGACTTCAAGTTGTTCAACTCGGACGCCAATGCAACTATATCGGCCATGGCTGGTGCGTCCACCTTTCGCGAGATATGT
AGAACCGTCCTGCAGAAGATGATCGACACCGTCCCCCCAGGCGTCACCCTGGGCGAGCCCATCACCCCGTATCAGGTGAAACCCGTCCAGCTACAGCTCACGCTCTCTCCGCAACTCGGT
GCCTTGGACTTCACCGGCTACATCCGCGTTCGGACCACCGAAATGCCCCTCGACACGATCGAGGGGTTGACCATCAACTACAGGAACCGAAACGGAGGGTCCGAGTGCGGGTCAGGACCT
TGCAGCTTCTCCCTGTCGGTCCAGGGCGTTGGTAGAGGCTTCGACGACACCTTTGCCTGGTTCCCAATCGCGCGGCAGCTGCCCGTCTCCTCAGGTATCTCGTCCTTCACCGTCACCATT
CGCAGGACAGACGGGACCAGCCTCCTCGTGGATAACAACGGCAACGGCTATCCCTTGCAAGACGGCGTCTTCCTCCAACGGTATCAGAGCTGTATCCTGGCCACCTCCGGAACGACTACC
CTGAGCGCCGCCGTCCGGAACGACCGTGCGGATCTTCCCGTCAAGGCCGTCATCTCGTACAAGACCCCGCAGACGGGGAGCGTCGTGCCGGCTCTGAACAACATGACGCTGGAGCTAACC
AAGGGGCCCTGCGTCGGCAGCTATACTCTATTCTCGGCGAGCACCACGATCCCGGGAGGCCTCAGCGTTGAAGCAGATTTCGACATCATCAGCGGAGAGGGCTCGTCAGCTCTGGTGGAT
TATTTCAAGAAGGCCAACATCCTTGGGGGTGCGTGCCAGTCGTTCCCACAGACGGGATCATGCACGACTCCCTCGTCGACGTCATCGTCTTCGGAGACCCCGGCCAGCACCGA
CTCTATT
GAATCCAACACGGCGTCTTCGACGACATCCAGCACGGTTCCGACAGAATCGCCCCACCACAGGGAGGTCATAGGCGAGTACAGGCTTGTCTCCTGCTGGACCGAGGGCGACGGGGTCCGC
GCCCTCAGCGGTGCGAGCTTCGCCTATGACTCGATGACCTTGGAGAGCTGCATGGCCAACTGCACCGGGTTTGACTATTGGGGTACCGAGTACGGCCGGGAATGCTACTGCGGCAACTCT
CTTCACGGGTCCACATCATCTGCGCCTCTTGACGAATGTGACATGGCTTGCGGCGGAGACGACACCCAGTATTGTGGCTCTGGTAACAGGCTGGAGCTCTACTCCACGACAGCAACCCGT
AGCAGCAGCGCCACGAGCTCTGCTCCGACTCCCACCGAAACACCGGTCCGCCTGCCGATGGTGTCCGACTATGCTCACGTCGGTTGCCAGACTGAGGGCGTCGGGGTTCGAGCTCTCCAG
GGGCCGGTCCTAGTGGACGATGACATGACGCTCGATATGTGTGCCGACTTCTGCTCAAATTATGTTTACTTTGGAACCGAATACGGCCGAGAGT
GCTATTGTGGCAACTCCCTCCATTCA
TCTAGCGAGCCCGCACCGTTAGAAGAGTGCGGAATGACATGCGCCGGAAACCCATTCCAATACTGCGGCGCCGGCAACCGAATCGAGCTGTACCGGGCGAACACCCCCTCCATGGTCGTA
CCCACGCCCACAGACAGCTCGTCTTGGGCATCCACAAGTAGCACACAAGAGTCGTCGACGACAACCATGACAGAGGCAAACCCCTCCCACCGGCCCACCGTCACTCCGTACATGCTCGTC
GGCTGCCAGACGGAAGGTACCGGTGCCCGTGCCCTCGACGGCCCCTCATACGCCTCAGGCACGGAGATGACGCTGGAGGCCTGCGCCGAGTTCTGCGAAGGATACCGTTACTTCGGCACG
CAATACAGCGCCGAGTGTTTCTGCGGGAACAGGCTGCACGACACCTCGCTCCCAGCCCCGCTCTCCGAATGTCCCATGCTCTGCTCCGGCAACCCGTCCGAGTACTGCGGCGGACCGGAC
CGCCTCACGCTATACCGCAACGACGACATCCCTTCGGAGGAGCCCGACCCGGAACCACGCCAGCCGGCTTTCGCGGGCGACGACTTTGTCTGGCTGGGATGCTGGACAGAGCCGGTAGCA
GCGGGCGCGCGGGCGTTGGACGGGCCGACGACGGCGTCGGACGACATGTCCAACGAGGTTTGCGCAGAGTTTTGTGACGGGTTTGCGTACTTTGGTACCGAGTACGGCCGGGAGTGTTTC
TGCGGCGACGAGATCCATGAGGGATCCGAGGAGTTGGATGAGGAGGAGTGCAATATGCGGTGCTCTGGCGCGAGGGACGAATTCTGTGGCAACTCGAATCGGCTTTCGGTATATGCACGA
GATGAGGACGCGGATACGGAATCGTAG

Retrieve as FASTA