Entry information : AalcLDS01
Entry ID 10718
Creation 2012-03-08 (Christophe Dunand)
Last sequence changes 2012-03-08 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: AalcLDS01
Name AalcLDS01
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Acremonium
Organism Acremonium alcalophilum    [TaxId: 398408 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AalcLDS01
start..stop
S start..stop
MgrLDS01 1558 0 62..1121 47..1109
GzLDS01 1518 0 11..1120 2..1105
GmoLDS01 1512 0 38..1120 24..1093
FoLDS01 1503 0 43..1120 27..1093
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 948014..948317 304 N° 2 948383..948621 239 N° 3 948718..948910 193 N° 4 948974..951603 2630
join(948014..948317,948383..948621,948718..948910,948974..951603)


exon

Literature and cross-references AalcLDS01
DNA ref. JGI genome:   scaffold_7 (948014..951603)
Cluster/Prediction ref. JGI gene:   1044362
Protein sequence: AalcLDS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1122
PWM (Da):   %s   125048.22  
PI (pH):   %s   8.35
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNGAHTSSATSEGSAEQGAVSKQEKQKNAVPQFEYLPTQGETKAKPFGGSIPKEKDGTVAGLQRLRQASKRPLPKRYGDGSYPVVATRPGAMEHIKALQYRDVKTLLEIVKGKIKGEKIKDDKTMIMERTIQLVAKLPHNSKTRDELTNTFIQELWDSLDHPPLLYVGDDARYRRADGSNNPLYPSLGAAGSTYARSCAPKKLNQGALPDPGLIFDSIFARTNYTKHPNNVSSVLWYWASIIIHDLFWTDHGDISKNKTSSYLDLSPLYGSNQAMQDTIRTFKDGKLKADSFADKRLMGMPPGVCVFLIMFNRFHNHVAENLAAINEGGRFTPPPPGLTGEKAEKAWKKYDNDLFQTARLITSGLYINITLIDYVRNIINLNRTDTSWTLDPRQEAGAHVGTKEGAEAGTGNVVSAEFNLCYRWHSCISEKDDKWIQDLYGEILGGGKGELTAPEMMRAFAKFDASIPSDPAERTFGGYKRQADGRFSDDDLAECMTAAIEDCAGSFGGRNVPQVMRPVEIMGILQGRKWNVSGLNEFRKSFGLKPYETFEDINSDPEIADALRHLYITPDNVELYPGIVAEENKMPMVPGVGIAPTYTISRVVLSDAVCLVRGDRHYTTDYTPRNLTNWGYKEVDYDRNVNHGCVFYKLFLRAFPNHFKANSVYAHYPMVVPSETHKILTDLGRVDEFDFSRPTYTPPRVNITSYGGAQHVLERQDVYKVVWHEGLGYLMGKGGRNFMLSGDTDFHAGQRKCMSAQLYKDGWKAAVKKFYAQITDQLLQEKSYTLGDAKQRHVDLVRDVGNIAHVHFSSRMFNLPLKSTKHPKGVFSEQEMYQLLAVIFVCIFFDLDPAKSFPLRQAALGASKKLGQVIETNVKLTTGLGLRGLFTASVDKNDPLADYGTRMIKGLSKSGLSAYEVAWSHVLPTAAAMVPNQAQVFAQAVDYYLSAEGEVHLAELHAVANQPVSEQTDALLLGYAMEGIRMAGTFGSYREVAADDVIVEDDGRRVEVKKGDRVFVSFVGAARDPTRFPSPEKVDPRRPLEAYIHYGLGPHACVGREASQVALTEMFRALFKRRNLRRQPGPLGELKKVPRPGGFFVYMREDLSALWPFPCSMKVMWDED

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACGGGGCCCATACCTCTTCCGCAACGTCCGAGGGCTCCGCGGAGCAGGGGGCCGTTTCCAAGCAGGAGAAGCAGAAAAACGCCGTACCGCAGTTTGAGTATCTCCCCACCCAGGGC
GAGACCAAAGCAAAGCCCTTCGGCGGTTCTATTCCCAAGGAGAAGGATGGGACGGTGGCCGGTCTCCAGAGACTGCGGCAAGCGTCGAAGCGGCCACTCCCCAAGCGGTACGGGGACGGT
TCCTACCCGGTGGTGGCGACCCGGCCCGGCGCCATGGAGCACATCAAGGCCCTTCAGTATAGAG
GTAGGCATGACGAACGCCCACTTCCCCCTTCACGTGCATGTCAGGACTAACATGGG
AAACATCAGATGTCAAGACCCTGCTCGAGATCGTCAAGGGCAAGATCAAAGGGGAGAAGATCAAGGATGACAAGACGATGATCATGGAACGTACCATCCAGCTCGTCGCCAAGCTGCCGC
ATAACTCCAAGACCCGCGACGAGCTGACCAACACCTTCATCCAAGAGCTCTGGGACTCGTTGGACCACCCTCCTCTGTTGTATGTCGGCGATGATGCGAGGTATCGGCGGGCTGATGGCT
CTAATAAT
GTGAGTTGACGACCGACTGTTATGAGGGGGATGGCAAAGTCCCATGCACGCACGATTTCGAGTGATGTTGCTAACTCGGTGGATTTTCCCATCAAGAACCCCCTGTATCCGA
GCTTGGGGGCCGCTGGATCGACCTACGCCCGCTCGTGCGCGCCCAAGAAGCTGAACCAGGGTGCTTTGCCCGATCCCGGGCTCATTTTCGACTCCATCTTCGCTCGTACCAACTACACAA
AGCACCCCAATAACGTCTCGTCTGTCCTGTGGTACTGGGCTTCTATCATTATCCACG
GTATGTAACGTACTTCTGCGGGTAGGGGCCGGTCGAAAGATCTTTTGCGCTAACTTTGGGAAG

ACTTGTTCTGGACGGACCACGGAGACATCTCCAAGAACAAGACATCGTCTTATCTGGACCTCTCGCCACTCTATGGAAGCAATCAAGCGATGCAGGATACGATCCGAACCTTCAAGGACG
GCAAGCTCAAGGCAGACAGTTTCGCCGACAAGCGCCTCATGGGCATGCCGCCCGGCGTCTGCGTCTTCCTCATCATGTTCAACCGGTTCCACAACCACGTTGCCGAGAACCTGGCCGCCA
TCAACGAGGGTGGTCGGTTTACTCCGCCGCCCCCCGGCCTCACGGGGGAGAAGGCCGAGAAGGCGTGGAAGAAGTACGACAACGACCTCTTCCAGACGGCCCGTCTCATCACGTCGGGCC
TGTATATCAACATCACGCTGATTGACTACGTCCGGAATATCATCAACCTGAACCGGACCGACACGAGCTGGACGCTGGACCCCCGTCAGGAAGCCGGCGCTCACGTCGGCACCAAGGAAG
GAGCCGAAGCCGGTACGGGTAATGTGGTGTCGGCCGAGTTCAACCTCTGCTACCGCTGGCATTCTTGCATCTCGGAAAAGGACGACAAGTGGATCCAGGACTTGTACGGCGAGATCCTGG
GAGGCGGCAAGGGCGAGCTCACGGCCCCCGAGATGATGCGAGCGTTCGCCAAGTTTGATGCTTCTATTCCGAGCGACCCGGCCGAGCGGACGTTTGGCGGGTATAAGCGCCAGGCGGACG
GCCGGTTCAGCGACGACGACCTGGCCGAGTGCATGACCGCGGCCATTGAGGACTGCGCCGGGTCCTTTGGAGGCCGGAACGTGCCCCAGGTGATGCGGCCGGTGGAGATTATGGGCATCC
TGCAGGGCCGCAAGTGGAACGTTTCCGGGCTGAACGAATTCCGCAAGTCGTTCGGCCTCAAGCCGTACGAGACCTTTGAAGACATCAATTCGGACCCGGAGATTGCCGATGCTCTACGTC
ACCTCTACATCACGCCCGATAATGTCGAGCTGTACCCCGGCATTGTGGCGGAGGAGAACAAGATGCCCATGGTACCGGGTGTGGGCATCGCGCCGACCTATACCATCTCCCGTGTCGTCC
TCTCGGACGCGGTGTGCCTCGTTCGGGGTGATCGCCATTACACGACGGATTACACGCCTCGCAACCTGACCAACTGGGGCTATAAGGAAGTTGACTACGACCGCAACGTCAACCATGGGT
GCGTTTTCTACAAGCTGTTCCTCCGGGCCTTCCCCAACCACTTCAAGGCCAACTCGGTATACGCGCACTACCCCATGGTGGTCCCCTCGGAGACGCACAAGATTCTCACGGACCTGGGCC
GGGTCGACGAGTTTGACTTTAGCCGGCCGACGTACACGCCGCCTCGCGTGAACATTACGTCGTACGGCGGCGCGCAGCACGTGCTGGAGCGCCAGGATGTGTACAAGGTGGTCTGGCACG
AAGGGCTGGGCTACCTCATGGGGAAGGGCGGGCGCAACTTTATGCTCTCGGGAGATACCGACTTCCACGCCGGGCAGCGCAAGTGCATGAGCGCACAGCTGTACAAGGATGGCTGGAAGG
CGGCGGTGAAGAAGTTTTATGCGCAGATCACCGACCAGCTGCTGCAGGAGAAGTCGTACACGCTGGGCGACGCGAAGCAGAGGCACGTCGACCTGGTCCGCGACGTGGGGAACATAGCGC
ACGTGCACTTTTCGTCGCGCATGTTCAACCTGCCGCTCAAGTCGACGAAGCACCCCAAGGGCGTCTTCTCGGAGCAGGAGATGTACCAGCTGCTGGCGGTCATCTTCGTGTGCATCTTCT
TCGACCTGGACCCGGCCAAGTCGTTCCCGCTGCGGCAGGCGGCGCTGGGGGCGTCGAAGAAGCTGGGCCAGGTGATCGAGACCAACGTCAAGCTGACGACGGGCCTCGGGCTGCGCGGGC
TGTTCACGGCGTCGGTGGACAAGAACGATCCCCTGGCGGACTACGGCACGAGGATGATCAAGGGCCTGTCCAAGTCCGGGCTGAGCGCGTACGAGGTGGCCTGGAGCCACGTGCTGCCGA
CGGCGGCGGCCATGGTCCCGAACCAGGCGCAGGTGTTCGCGCAGGCGGTGGACTACTACCTCTCGGCCGAGGGCGAGGTCCACCTGGCGGAGCTGCACGCGGTGGCCAACCAGCCGGTGT
CGGAGCAGACGGACGCGCTGCTGCTCGGGTACGCGATGGAGGGGATCCGGATGGCGGGGACGTTCGGGTCGTACCGCGAGGTGGCGGCGGACGACGTGATTGTGGAGGACGACGGGCGGC
GGGTGGAGGTCAAGAAGGGTGACCGGGTGTTTGTGAGCTTCGTCGGGGCGGCGCGGGATCCGACGCGGTTCCCGTCGCCGGAGAAGGTGGACCCCCGCCGGCCGCTGGAGGCGTACATCC
ACTACGGGCTCGGCCCGCATGCGTGCGTCGGGCGCGAGGCGAGCCAGGTGGCGCTGACGGAGATGTTCCGGGCGCTGTTCAAGCGGCGCAACCTGCGGCGGCAGCCGGGCCCGCTGGGCG
AGCTGAAGAAGGTGCCTCGGCCCGGCGGGTTCTTCGTGTATATGCGCGAGGACTTGAGTGCGCTCTGGCCTTTCCCGTGTTCGATGAAGGTGATGTGGGATGAGGACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACGGGGCCCATACCTCTTCCGCAACGTCCGAGGGCTCCGCGGAGCAGGGGGCCGTTTCCAAGCAGGAGAAGCAGAAAAACGCCGTACCGCAGTTTGAGTATCTCCCCACCCAGGGC
GAGACCAAAGCAAAGCCCTTCGGCGGTTCTATTCCCAAGGAGAAGGATGGGACGGTGGCCGGTCTCCAGAGACTGCGGCAAGCGTCGAAGCGGCCACTCCCCAAGCGGTACGGGGACGGT
TCCTACCCGGTGGTGGCGACCCGGCCCGGCGCCATGGAGCACATCAAGGCCCTTCAGTATAGAG
ATGTCAAGACCCTGCTCGAGATCGTCAAGGGCAAGATCAAAGGGGAGAAGATCAAG
GATGACAAGACGATGATCATGGAACGTACCATCCAGCTCGTCGCCAAGCTGCCGCATAACTCCAAGACCCGCGACGAGCTGACCAACACCTTCATCCAAGAGCTCTGGGACTCGTTGGAC
CACCCTCCTCTGTTGTATGTCGGCGATGATGCGAGGTATCGGCGGGCTGATGGCTCTAATAAT
AACCCCCTGTATCCGAGCTTGGGGGCCGCTGGATCGACCTACGCCCGCTCGTGCGCG
CCCAAGAAGCTGAACCAGGGTGCTTTGCCCGATCCCGGGCTCATTTTCGACTCCATCTTCGCTCGTACCAACTACACAAAGCACCCCAATAACGTCTCGTCTGTCCTGTGGTACTGGGCT
TCTATCATTATCCACG
ACTTGTTCTGGACGGACCACGGAGACATCTCCAAGAACAAGACATCGTCTTATCTGGACCTCTCGCCACTCTATGGAAGCAATCAAGCGATGCAGGATACGATC
CGAACCTTCAAGGACGGCAAGCTCAAGGCAGACAGTTTCGCCGACAAGCGCCTCATGGGCATGCCGCCCGGCGTCTGCGTCTTCCTCATCATGTTCAACCGGTTCCACAACCACGTTGCC
GAGAACCTGGCCGCCATCAACGAGGGTGGTCGGTTTACTCCGCCGCCCCCCGGCCTCACGGGGGAGAAGGCCGAGAAGGCGTGGAAGAAGTACGACAACGACCTCTTCCAGACGGCCCGT
CTCATCACGTCGGGCCTGTATATCAACATCACGCTGATTGACTACGTCCGGAATATCATCAACCTGAACCGGACCGACACGAGCTGGACGCTGGACCCCCGTCAGGAAGCCGGCGCTCAC
GTCGGCACCAAGGAAGGAGCCGAAGCCGGTACGGGTAATGTGGTGTCGGCCGAGTTCAACCTCTGCTACCGCTGGCATTCTTGCATCTCGGAAAAGGACGACAAGTGGATCCAGGACTTG
TACGGCGAGATCCTGGGAGGCGGCAAGGGCGAGCTCACGGCCCCCGAGATGATGCGAGCGTTCGCCAAGTTTGATGCTTCTATTCCGAGCGACCCGGCCGAGCGGACGTTTGGCGGGTAT
AAGCGCCAGGCGGACGGCCGGTTCAGCGACGACGACCTGGCCGAGTGCATGACCGCGGCCATTGAGGACTGCGCCGGGTCCTTTGGAGGCCGGAACGTGCCCCAGGTGATGCGGCCGGTG
GAGATTATGGGCATCCTGCAGGGCCGCAAGTGGAACGTTTCCGGGCTGAACGAATTCCGCAAGTCGTTCGGCCTCAAGCCGTACGAGACCTTTGAAGACATCAATTCGGACCCGGAGATT
GCCGATGCTCTACGTCACCTCTACATCACGCCCGATAATGTCGAGCTGTACCCCGGCATTGTGGCGGAGGAGAACAAGATGCCCATGGTACCGGGTGTGGGCATCGCGCCGACCTATACC
ATCTCCCGTGTCGTCCTCTCGGACGCGGTGTGCCTCGTTCGGGGTGATCGCCATTACACGACGGATTACACGCCTCGCAACCTGACCAACTGGGGCTATAAGGAAGTTGACTACGACCGC
AACGTCAACCATGGGTGCGTTTTCTACAAGCTGTTCCTCCGGGCCTTCCCCAACCACTTCAAGGCCAACTCGGTATACGCGCACTACCCCATGGTGGTCCCCTCGGAGACGCACAAGATT
CTCACGGACCTGGGCCGGGTCGACGAGTTTGACTTTAGCCGGCCGACGTACACGCCGCCTCGCGTGAACATTACGTCGTACGGCGGCGCGCAGCACGTGCTGGAGCGCCAGGATGTGTAC
AAGGTGGTCTGGCACGAAGGGCTGGGCTACCTCATGGGGAAGGGCGGGCGCAACTTTATGCTCTCGGGAGATACCGACTTCCACGCCGGGCAGCGCAAGTGCATGAGCGCACAGCTGTAC
AAGGATGGCTGGAAGGCGGCGGTGAAGAAGTTTTATGCGCAGATCACCGACCAGCTGCTGCAGGAGAAGTCGTACACGCTGGGCGACGCGAAGCAGAGGCACGTCGACCTGGTCCGCGAC
GTGGGGAACATAGCGCACGTGCACTTTTCGTCGCGCATGTTCAACCTGCCGCTCAAGTCGACGAAGCACCCCAAGGGCGTCTTCTCGGAGCAGGAGATGTACCAGCTGCTGGCGGTCATC
TTCGTGTGCATCTTCTTCGACCTGGACCCGGCCAAGTCGTTCCCGCTGCGGCAGGCGGCGCTGGGGGCGTCGAAGAAGCTGGGCCAGGTGATCGAGACCAACGTCAAGCTGACGACGGGC
CTCGGGCTGCGCGGGCTGTTCACGGCGTCGGTGGACAAGAACGATCCCCTGGCGGACTACGGCACGAGGATGATCAAGGGCCTGTCCAAGTCCGGGCTGAGCGCGTACGAGGTGGCCTGG
AGCCACGTGCTGCCGACGGCGGCGGCCATGGTCCCGAACCAGGCGCAGGTGTTCGCGCAGGCGGTGGACTACTACCTCTCGGCCGAGGGCGAGGTCCACCTGGCGGAGCTGCACGCGGTG
GCCAACCAGCCGGTGTCGGAGCAGACGGACGCGCTGCTGCTCGGGTACGCGATGGAGGGGATCCGGATGGCGGGGACGTTCGGGTCGTACCGCGAGGTGGCGGCGGACGACGTGATTGTG
GAGGACGACGGGCGGCGGGTGGAGGTCAAGAAGGGTGACCGGGTGTTTGTGAGCTTCGTCGGGGCGGCGCGGGATCCGACGCGGTTCCCGTCGCCGGAGAAGGTGGACCCCCGCCGGCCG
CTGGAGGCGTACATCCACTACGGGCTCGGCCCGCATGCGTGCGTCGGGCGCGAGGCGAGCCAGGTGGCGCTGACGGAGATGTTCCGGGCGCTGTTCAAGCGGCGCAACCTGCGGCGGCAG
CCGGGCCCGCTGGGCGAGCTGAAGAAGGTGCCTCGGCCCGGCGGGTTCTTCGTGTATATGCGCGAGGACTTGAGTGCGCTCTGGCCTTTCCCGTGTTCGATGAAGGTGATGTGGGATGAG
GACTAG

Retrieve as FASTA