Entry information : AalcLDS02
Entry ID 10719
Creation 2012-03-08 (Christophe Dunand)
Last sequence changes 2012-03-08 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: AalcLDS02
Name AalcLDS02
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Acremonium
Organism Acremonium alcalophilum    [TaxId: 398408 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AalcLDS02
start..stop
S start..stop
GmoLDS02 1747 0 1..1153 1..1150
GzLDS02 1719 0 1..1153 1..1150
AteLDS02 1140 0 6..1115 91..1132
AflLDS02 1131 0 4..1126 158..1236
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2596467..2596681 215 N° 2 2593789..2596417 2629 N° 3 2593511..2593729 219 N° 4 2593183..2593459 277
N° 5 2592996..2593126 131  
complement(join(2592996..2593126,2593183..2593459,2593511..2593729,2593789..2596 417,2596467..2596681))


exon

Literature and cross-references AalcLDS02
DNA ref. JGI genome:   scaffold_8 (2596681..2592996)
Cluster/Prediction ref. JGI gene:   2044747
Protein sequence: AalcLDS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1158
PWM (Da):   %s   129959.29  
PI (pH):   %s   6.41
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTFDEKFQAGEAYGNGDAHHGSRDFLLEDPVKIATQLVKDYAGVRRMASIPELAALIRQLLHKGEPIDDRQGTTELLIGILAGLPSDSKLRTQLTNKLIDTLWDDLQHPPLSYVGGDVKYEVVDSKEQGPHLPTKNYDSIEFKVPGTDVTLREHAPQSPDGVFQYRMPDGSFNNVLDPNLGKAGSSYAKSVRATKTLHGVKPDPGLLFDLLMARDDENFKENEAGISSMLFYHASIIIHDIFRTSRTDMNKTDTSSYLDLAPLYGSSLKDQLEVRTMKHGKLKPDTFHEKRLLGQPAGVNVMLVLYSRFHNYVCDVLLQINENGRFTLACGDDASPEQKAQAAAKQDHDLFNTARLIVGGLYINISLHDYLRAITNTHHSDSDWTLDPRVDMSKQYDDEGAPRGVGNQVSVEFNLLYRFHACISKKDERWMENFFLKLFPGHTVEDLPNISWTELGKALAAYEATIPKDPSARTFDGLERQEDGTFKDEDLVRILKEAMEDPAGSFGARRIPKALKIVEILGINQARKWQVASLNEFREFFGLKRYEAFTDINANPDIAGILEKLYTDPDMVELYPGLMIEDIKPVRNPGCGITPNYTLGRAVLSDAITLVRSDRFNTLDYTVANLTAWGYNEVQQDYKTLGGSMLYKLIQRGLPNWFPYNSIAVMQPMYTKKANEKIAKELGTIHQFTLDDPKPPRKAVVISTGAAIKQALGDPAKFTVPWLQPINDMFPGPKGKDLGWFMLAGDGPENRKNREDMTKAMGNIPNLHGAVREFIERVGAQLLEKETFTLREGLHQIDLIRDIAIPLNAQLLSDMFYFDLRTDENPDGTLSAAEFYRHLLNIRTWGANNNDPAQAWNRRRRAQEGADVIIKTTRKLVDEVSRSRGLGFGVASALSNVLTRKTHIKKDSLRACGLKFVEELLAQGHSAERVVDTLWLTAFGGVGAPVTFYEIMEYFLHKDNAAIWAEVQRLVRKNDDATLSAYIREAQRLTSSQRNVRVATQPAELEGQSIQPGNVVIMLMGNAGRNPDEVVNANTFDPNRKTDEVGAFSYGPHECFGKHIATTFITGLVKLVADLKKLRPAPRNMGEVKTVRIGSEKSYLNDSWSYLSFDPSTWKLHFDGRGEGVFEDDGEPEKETEMQKYYYAIKERKAKLRLF

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTTCGATGAAAAGTTCCAGGCCGGTGAAGCGTACGGCAACGGAGATGCCCACCATGGTTCGAGAGACTTCCTTCTCGAAGACCCCGTCAAGATTGCTACCCAGCTGGTGAAAGAC
TATGCTGGTGTTCGACGCATGGCTTCCATCCCAGAACTCGCAGCCCTTATCAGGCAGCTGCTGCACAAGGGGGAGCCCATTGACGACAGACAGGG
GTAAGGAATCTACTGCCTTTACTTG
AAGTCTCCCTCTGACGATCGACAGCACGACCGAGCTCTTGATCGGCATTCTCGCAGGTCTCCCCTCCGATTCGAAGCTCAGAACCCAGCTCACAAACAAGCTCATCGACACTCTCTGGGA
CGATCTCCAACACCCGCCCCTGAGCTATGTTGGTGGCGACGTCAAGTACGAGGTAGTCGACTCCAAGGAGCAAGGCCCTCACCTGCCTACAAAGAACTATGACAGCATCGAGTTCAAGGT
CCCTGGTACCGACGTGACCCTGCGTGAGCACGCACCGCAATCCCCGGACGGTGTCTTTCAATACCGAATGCCCGACGGGAGCTTCAACAACGTCCTCGATCCCAACTTGGGCAAGGCCGG
CTCTTCCTATGCCAAGTCGGTCCGGGCAACCAAGACGCTCCACGGAGTCAAGCCAGACCCGGGTCTGCTCTTCGACCTCCTGATGGCTCGGGATGACGAGAACTTCAAAGAGAACGAGGC
CGGCATCTCGTCCATGCTCTTCTACCATGCCTCCATTATCATCCACGACATCTTCCGGACCAGCCGTACCGACATGAACAAGACCGATACGTCCTCGTACCTCGACCTGGCGCCCCTGTA
CGGCTCCTCGCTCAAGGACCAGCTCGAGGTTCGTACCATGAAGCACGGCAAGCTGAAGCCGGACACCTTCCACGAGAAGCGGCTTCTGGGCCAGCCAGCCGGCGTCAATGTCATGCTGGT
CCTCTACAGCCGCTTTCACAACTACGTCTGCGACGTCTTGCTCCAGATCAACGAGAACGGACGCTTCACGCTGGCATGCGGAGACGATGCCTCGCCGGAGCAAAAGGCCCAGGCGGCCGC
CAAGCAGGACCACGACCTCTTCAACACGGCCCGCCTCATCGTGGGTGGCCTGTACATCAACATTTCCCTGCACGACTACCTCCGGGCCATCACCAACACGCACCACTCCGACAGCGACTG
GACGCTGGACCCGCGCGTTGACATGAGCAAGCAGTACGACGACGAGGGCGCCCCGCGTGGCGTCGGCAACCAGGTCAGCGTCGAATTCAACCTGCTCTACCGCTTCCACGCCTGTATCTC
TAAGAAGGACGAGCGCTGGATGGAAAACTTCTTCCTCAAGCTCTTCCCCGGCCATACAGTGGAAGACCTGCCCAACATCAGCTGGACGGAGCTCGGCAAGGCCCTGGCGGCGTACGAGGC
GACCATCCCCAAGGACCCGAGCGCCCGCACGTTCGACGGCCTCGAGCGTCAGGAGGACGGGACGTTCAAGGACGAAGACCTCGTGCGCATCCTCAAGGAGGCCATGGAGGACCCGGCCGG
TTCCTTTGGCGCCCGGAGAATCCCCAAGGCGCTCAAGATTGTCGAGATTCTCGGTATCAACCAGGCGCGCAAGTGGCAGGTCGCTTCTCTGAACGAGTTCCGCGAGTTCTTCGGACTCAA
GCGCTACGAAGCCTTCACTGATATCAATGCCAACCCCGACATTGCCGGCATTCTCGAGAAGCTCTATACCGACCCCGATATGGTGGAACTCTACCCTGGGCTCATGATCGAGGACATCAA
ACCCGTCCGTAACCCCGGTTGTGGTATCACCCCGAACTACACGCTCGGTCGTGCCGTGCTCTCGGACGCCATCACGCTGGTGCGTTCGGACAGGTTCAACACCCTCGACTACACCGTCGC
CAACTTGACGGCCTGGGGGTACAACGAAGTCCAGCAGGACTACAAGACCCTCGGCGGCTCCATGCTGTACAAGCTCATCCAGCGCGGTCTTCCCAACTGGTTCCCCTACAACTCCATCGC
CGTCATGCAGCCCATGTACACCAAGAAGGCCAACGAGAAGATTGCAAAGGAGCTCGGCACCATCCACCAGTTCACGCTAGACGATCCCAAGCCTCCCCGCAAGGCCGTCGTCATCTCCAC
CGGCGCCGCCATCAAGCAGGCGCTCGGCGACCCGGCCAAGTTCACCGTGCCGTGGCTCCAGCCCATCAACGACATGTTCCCCGGACCAAAGGGTAAGGACCTGGGATGGTTCATGTTGGC
GGGCGACGGGCCCGAAAACCGGAAGAACCGCGAAGACATGACCAAGGCCATGGGCAATATTCCCAACCTGCACGGCGCCGTGCGCGAGTTTATCGAACGCGTGGGCGCGCAGCTTCTCGA
AAAGGAGACCTTCACGCTCAGGGAGGGCCTCCACCAGATCGACCTGATCCGCGACATTGCCATCCCTCTCAACGCCCAGCTCCTGTCGGACATGTTCTACTTTGACCTGCGCACCGACGA
GAATCCGGACGGCACTCTGAGCGCGGCCGAGTTTTACCGCCACCTGCTCAACATTCGCACCTGGGGCGCCAACAACAACGACCCCGCGCAGGCCTGGAACCGCCGCCGACGGGCGCAGGA
GGGCGCTGATGTCATTATCAAAACGACCCGCAAGCTCGTCGACGAGGTTTCCCGCAGCCGGGGCTTGGGCTTTGGTGTGGCGTCGGCTCTTTCCAACGTGCTCACCCGGAAGACCCATAT
CAAGAAAGACTCGCTGCGCGCCTGTGGCCTCAAGTTTGTCGAGGAGTTGCTGGCTCAGGGGCACTCTGCTGAGCGTGTTGTCGATACCCTGTGGCTGACGGCTTTCGGCGGCGTTGGAGC
GCCTGTTACTGCG
GTAAGCTATTCACCCCTGGTGCAGAAAAGGGGGGGACTGCGTGCTAATGTTCTGTCTAGTTCTACGAGATCATGGAGTATTTCCTCCACAAGGACAACGCGGCCATC
TGGGCCGAAGTTCAGCGCTTGGTGCGAAAGAACGACGACGCTACCCTCAGCGCCTACATCCGGGAGGCACAGCGCCTCACGAGCTCGCAGCGTAATGTGCGCGTTGCGACGCAGCCGGCT
GAGCTGGAGGGTCAGTCGATCCAGCCAGGAAACGTCGTCATCATGCTCATG
GTATGTATTATACATTGTCCCTTGTATGAACAGCCCTAACGCTCTTCCCAGGGTAACGCTGGACGAAAC
CCCGATGAGGTGGTCAACGCGAACACGTTCGATCCGAACCGCAAGACGGACGAAGTCGGAGCCTTTAGCTACGGGCCTCACGAATGTTTCGGAAAACACATCGCAACCACTTTCATCACC
GGCCTTGTGAAGCTCGTTGCTGATCTCAAGAAACTGCGTCCCGCGCCGCGCAACATGGGCGAGGTCAAGACGGTCCGTATTGGGAGTGAGAAGTCGTACCTCAACGACAGCTGGTCTTAC
CTTAGCTTTGACCCAAGCA
GTACGTTTACGAGTTCCCTTGCCCTGGTCCCTACTCCGTGCTAATCTCTCTTATAGCCTGGAAGCTTCACTTTGATGGCCGAGGGGAGGGCGTATTTGAGG
ATGATGGGGAGCCAGAAAAGGAGACTGAAATGCAGAAGTATTACTACGCGATCAAAGAGCGCAAGGCTAAGCTTAGGCTCTTTAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTTCGATGAAAAGTTCCAGGCCGGTGAAGCGTACGGCAACGGAGATGCCCACCATGGTTCGAGAGACTTCCTTCTCGAAGACCCCGTCAAGATTGCTACCCAGCTGGTGAAAGAC
TATGCTGGTGTTCGACGCATGGCTTCCATCCCAGAACTCGCAGCCCTTATCAGGCAGCTGCTGCACAAGGGGGAGCCCATTGACGACAGACAGGG
CACGACCGAGCTCTTGATCGGCATT
CTCGCAGGTCTCCCCTCCGATTCGAAGCTCAGAACCCAGCTCACAAACAAGCTCATCGACACTCTCTGGGACGATCTCCAACACCCGCCCCTGAGCTATGTTGGTGGCGACGTCAAGTAC
GAGGTAGTCGACTCCAAGGAGCAAGGCCCTCACCTGCCTACAAAGAACTATGACAGCATCGAGTTCAAGGTCCCTGGTACCGACGTGACCCTGCGTGAGCACGCACCGCAATCCCCGGAC
GGTGTCTTTCAATACCGAATGCCCGACGGGAGCTTCAACAACGTCCTCGATCCCAACTTGGGCAAGGCCGGCTCTTCCTATGCCAAGTCGGTCCGGGCAACCAAGACGCTCCACGGAGTC
AAGCCAGACCCGGGTCTGCTCTTCGACCTCCTGATGGCTCGGGATGACGAGAACTTCAAAGAGAACGAGGCCGGCATCTCGTCCATGCTCTTCTACCATGCCTCCATTATCATCCACGAC
ATCTTCCGGACCAGCCGTACCGACATGAACAAGACCGATACGTCCTCGTACCTCGACCTGGCGCCCCTGTACGGCTCCTCGCTCAAGGACCAGCTCGAGGTTCGTACCATGAAGCACGGC
AAGCTGAAGCCGGACACCTTCCACGAGAAGCGGCTTCTGGGCCAGCCAGCCGGCGTCAATGTCATGCTGGTCCTCTACAGCCGCTTTCACAACTACGTCTGCGACGTCTTGCTCCAGATC
AACGAGAACGGACGCTTCACGCTGGCATGCGGAGACGATGCCTCGCCGGAGCAAAAGGCCCAGGCGGCCGCCAAGCAGGACCACGACCTCTTCAACACGGCCCGCCTCATCGTGGGTGGC
CTGTACATCAACATTTCCCTGCACGACTACCTCCGGGCCATCACCAACACGCACCACTCCGACAGCGACTGGACGCTGGACCCGCGCGTTGACATGAGCAAGCAGTACGACGACGAGGGC
GCCCCGCGTGGCGTCGGCAACCAGGTCAGCGTCGAATTCAACCTGCTCTACCGCTTCCACGCCTGTATCTCTAAGAAGGACGAGCGCTGGATGGAAAACTTCTTCCTCAAGCTCTTCCCC
GGCCATACAGTGGAAGACCTGCCCAACATCAGCTGGACGGAGCTCGGCAAGGCCCTGGCGGCGTACGAGGCGACCATCCCCAAGGACCCGAGCGCCCGCACGTTCGACGGCCTCGAGCGT
CAGGAGGACGGGACGTTCAAGGACGAAGACCTCGTGCGCATCCTCAAGGAGGCCATGGAGGACCCGGCCGGTTCCTTTGGCGCCCGGAGAATCCCCAAGGCGCTCAAGATTGTCGAGATT
CTCGGTATCAACCAGGCGCGCAAGTGGCAGGTCGCTTCTCTGAACGAGTTCCGCGAGTTCTTCGGACTCAAGCGCTACGAAGCCTTCACTGATATCAATGCCAACCCCGACATTGCCGGC
ATTCTCGAGAAGCTCTATACCGACCCCGATATGGTGGAACTCTACCCTGGGCTCATGATCGAGGACATCAAACCCGTCCGTAACCCCGGTTGTGGTATCACCCCGAACTACACGCTCGGT
CGTGCCGTGCTCTCGGACGCCATCACGCTGGTGCGTTCGGACAGGTTCAACACCCTCGACTACACCGTCGCCAACTTGACGGCCTGGGGGTACAACGAAGTCCAGCAGGACTACAAGACC
CTCGGCGGCTCCATGCTGTACAAGCTCATCCAGCGCGGTCTTCCCAACTGGTTCCCCTACAACTCCATCGCCGTCATGCAGCCCATGTACACCAAGAAGGCCAACGAGAAGATTGCAAAG
GAGCTCGGCACCATCCACCAGTTCACGCTAGACGATCCCAAGCCTCCCCGCAAGGCCGTCGTCATCTCCACCGGCGCCGCCATCAAGCAGGCGCTCGGCGACCCGGCCAAGTTCACCGTG
CCGTGGCTCCAGCCCATCAACGACATGTTCCCCGGACCAAAGGGTAAGGACCTGGGATGGTTCATGTTGGCGGGCGACGGGCCCGAAAACCGGAAGAACCGCGAAGACATGACCAAGGCC
ATGGGCAATATTCCCAACCTGCACGGCGCCGTGCGCGAGTTTATCGAACGCGTGGGCGCGCAGCTTCTCGAAAAGGAGACCTTCACGCTCAGGGAGGGCCTCCACCAGATCGACCTGATC
CGCGACATTGCCATCCCTCTCAACGCCCAGCTCCTGTCGGACATGTTCTACTTTGACCTGCGCACCGACGAGAATCCGGACGGCACTCTGAGCGCGGCCGAGTTTTACCGCCACCTGCTC
AACATTCGCACCTGGGGCGCCAACAACAACGACCCCGCGCAGGCCTGGAACCGCCGCCGACGGGCGCAGGAGGGCGCTGATGTCATTATCAAAACGACCCGCAAGCTCGTCGACGAGGTT
TCCCGCAGCCGGGGCTTGGGCTTTGGTGTGGCGTCGGCTCTTTCCAACGTGCTCACCCGGAAGACCCATATCAAGAAAGACTCGCTGCGCGCCTGTGGCCTCAAGTTTGTCGAGGAGTTG
CTGGCTCAGGGGCACTCTGCTGAGCGTGTTGTCGATACCCTGTGGCTGACGGCTTTCGGCGGCGTTGGAGCGCCTGTTACTGCG
TTCTACGAGATCATGGAGTATTTCCTCCACAAGGAC
AACGCGGCCATCTGGGCCGAAGTTCAGCGCTTGGTGCGAAAGAACGACGACGCTACCCTCAGCGCCTACATCCGGGAGGCACAGCGCCTCACGAGCTCGCAGCGTAATGTGCGCGTTGCG
ACGCAGCCGGCTGAGCTGGAGGGTCAGTCGATCCAGCCAGGAAACGTCGTCATCATGCTCATG
GGTAACGCTGGACGAAACCCCGATGAGGTGGTCAACGCGAACACGTTCGATCCGAAC
CGCAAGACGGACGAAGTCGGAGCCTTTAGCTACGGGCCTCACGAATGTTTCGGAAAACACATCGCAACCACTTTCATCACCGGCCTTGTGAAGCTCGTTGCTGATCTCAAGAAACTGCGT
CCCGCGCCGCGCAACATGGGCGAGGTCAAGACGGTCCGTATTGGGAGTGAGAAGTCGTACCTCAACGACAGCTGGTCTTACCTTAGCTTTGACCCAAGCA
CCTGGAAGCTTCACTTTGAT
GGCCGAGGGGAGGGCGTATTTGAGGATGATGGGGAGCCAGAAAAGGAGACTGAAATGCAGAAGTATTACTACGCGATCAAAGAGCGCAAGGCTAAGCTTAGGCTCTTTAAC

Retrieve as FASTA