Entry information : ScomLDS01
Entry ID 10727
Creation 2012-03-08 (Christophe Dunand)
Last sequence changes 2012-04-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-02-10 (Christophe Dunand)
Peroxidase information: ScomLDS01
Name ScomLDS01
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Schizophyllaceae Schizophyllum
Organism Schizophyllum commune    [TaxId: 5334 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ScomLDS01
start..stop
S start..stop
JargLDS01 1030 0 3..1109 5..1067
LbiLDS01 968 0 3..1109 6..1070
CcinLDS01 917 0 2..1109 3..1086
AbLDS01_burnettii 916 0 2..1108 6..1081
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 415610..415888 279 N° 2 415928..416021 94 N° 3 416087..416242 156 N° 4 416295..416488 194
N° 5 416544..416621 78 N° 6 416683..416799 117 N° 7 416957..417110 154 N° 8 417170..417304 135
N° 9 417360..417457 98 N° 10 417543..417739 197 N° 11 417796..417889 94 N° 12 417959..418084 126
N° 13 418141..418279 139 N° 14 418330..418383 54 N° 15 418438..418585 148 N° 16 418641..418797 157
N° 17 418848..419024 177 N° 18 419073..419158 86 N° 19 419210..419345 136 N° 20 419396..419696 301
N° 21 419747..419865 119 N° 22 419916..420001 86 N° 23 420053..420160 108 N° 24 420216..420306 91
N° 25 420359..420370 12  
join(415610..415888,415928..416021,416087..416242,416295..416488,416544..416621, 416683..416799,416957..417110,417170..417304,417360..417457,417543..417739,41779 6..417889,417959..418084,418141..418279,418330..418383,418438..418585,418641..41 8797,418848..419024,419073..419158,419210..419345,419396..419696,419747..419865, 419916..420001,420053..420160,420216..420306,420359..420370)


exon

Literature and cross-references ScomLDS01
DNA ref. JGI genome:   scaffold_19 (415610..420370)
EST ref. GenBank:   GW386594.1 [3' end]   GW386593.1 [Fragment]
Cluster/Prediction ref. JGI gene:   1177102
Protein sequence: ScomLDS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1111
PWM (Da):   %s   123209.55  
PI (pH):   %s   6.34
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSIIQRLAGGADFVLASTAPVDTDGGKPRPRYVVGQKLDELVQYLKNPPAQLDSLVSISIPYILDAKLTKCSEPAYLDAVKHMHSGLDDRKLLPAQLEHLLTLMARLGSGNDFSSRVQEAVIDLLYKDLPHPPACYLSVLHQAGLNLNVPLANVNYAYRTADGSYYNPLFPTLGMAGTPYARSVPSANCTPLNNLPDAGLVFDTLLRRKEGTFKEHEGGMSSLFFAMADLIIHCIFDTDHDITKNNTSSYLDLSILYGNSEEQLNGVRRHDGTGRLWDDVFADRRLLLMPPSTCALLVLFCRNHNHIAQRILDINEKGKYRSVDSFSDDARKAQDDEIFHRARLVNCGFFMQVILADYVGAILGLVRDGLPWRLDPLMTMRRESHEFSPQGEGNVVSIEFNLLYRWHAALSAQDTKWTEGLFKSVFGQDVDFDVTPTDFKRVVGRMFGQPQDPRTATFTDYAGQRLERHPEEGAATPDGAGRFADADLARVLQDATSWRAGSYGARAIPAALRVIEVMGIEQSREWGTCLNEFRHFMGLKKYDSFKDWNPDPVVHKQAETLYKDINNLELHVGMQAEAIKTPGPGAGLCPGYTISRAILGDAVALTRGDRFLTTEYTPNNLTRWGFKYSHVDPDDGSVGGILPRMLLATLPDHYPSGSAYTHFPFLEPAYIRNEMRKRGDKNLDRYTWDRPAVPAPLTVISTWAEAVEVLDTQKARFVSSYPQRLKDVTGVDADSKLARKTLLRLAPRLPAYFASKTMELINASPVTYVDADTKTVDIGRHVINLLPVHWISQQLACIALKTESNPLGTEYESDVCDMFENVCRYVYLDNDTYNHFRLQTDARKAFEHLTSFTARKLRAMTGSRISVSITQTLSRFILKEDDSTPFLRALLEGSDGADADTLAAHLFAEVVPTAAHFSRIVMQVVDFFLGSDEEGDEKRQAREAIVALASQCTAEADKQVMKYVDEALRLEPAVSGVYRTASAAAVVGNQRIEAGQRVYVALSAAKQSSVFGADTSTADFKRSTPSSTRLGLPDSGLLIPQLFDRILPRVLGVIFGLKNLRRAPGQSGVMSSFTQTLHGAPEKLFFDFDGNVTPIPESLFVYDF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (24 introns) and 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCATCATTCAGCGCCTCGCTGGCGGCGCCGACTTCGTGCTCGCGAGCACGGCGCCCGTCGACACCGACGGTGGAAAGCCACGACCGCGTTATGTCGTCGGTCAGAAGCTCGATGAG
CTCGTTCAGTACCTGAAGAACCCGCCCGCGCAACTCGACAGTCTGGTGAGCATCAGCATCCCCTACATTCTGGACGCAAAACTGACGAAATGCTCCGAGCCCGCTTACCTCGACGCGGTC
AAGCACATGCATTCTGGCCTTGACGATCGCAAGCTGTTG
GTGAGCAACACGTCTACTTACGATGCGCTCCTCGCTTAGCCTGCGCAGTTGGAGCACTTGCTCACCCTCATGGCGCGCCTC
GGCAGCGGCAATGACTTTTCGAGCAGGGTCCAAGAGGCGGTCATTGATTTAC
GTGAGTAAATAACCGCATATATGCGCCTCAAATCCCCGCTAGTACGACTGCTGACCGTTTTCCAGTCT
ACAAGGACCTGCCCCACCCTCCGGCATGCTACCTCTCCGTGCTACACCAAGCGGGCCTCAATCTCAACGTCCCGCTCGCGAACGTCAATTACGCCTATCGCACCGCGGACGGATCCTACT
ACAACCCTCTCTTTCCTACCCTAGGCATGGCTG
GTACGCGTGTCCGCCCTTTGGAAATGGCTGCAAAAGCTGACTGAGAATTTAGGTACACCATACGCCCGATCGGTGCCCTCAGCGAAC
TGTACTCCTCTCAATAATCTACCTGACGCCGGCCTTGTGTTCGATACACTACTTCGACGCAAGGAAGGCACTTTCAAGGAGCACGAAGGCGGGATGTCAAGCCTTTTCTTCGCTATGGCC
GACCTAATAATTCATTGTATATTCGATACCGACCATAAG
GTGCGTGCAGAATTCTCGTGTATACTGCTGAAACCTTGCGCTGACCCCAGCCCAGGATATAACGAAGAACAACACGAGCAG
CTACCTGGACCTGAGTATCCTCTATGGTAATTCGGAAGAGCAATTGAACGGC
GTACGTAGGCAATTGCCTTGCCGCTTCCAATATGTATGCGCATACTGAAGAATGGTCGCAGGTCCGCC
GCCACGATGGCACTGGGCGCCTCTGGGACGACGTATTCGCAGACCGCAGACTGCTCCTCATGCCACCGAGCACGTGCGCGCTGCTCGTGCTCTTTTGTCGCAATCATAAT
GTGAGTGGAC
TGGTTCGCATGATGTGCCCATACAAGCGCGCATATAAGGTGTTTTTTCGCGTGCATAGCCTGGCTATATGCAGTGAGATTGACCATCGACCATATATGCGTCGAGGTAATCGTCTGTATA
TGCGTCGAAACTAATCGTCTTTCGCAGCACATCGCCCAGCGCATCCTCGATATCAACGAGAAGGGCAAGTACCGCTCCGTCGACAGCTTCAGCGACGATGCTCGCAAGGCGCAGGACGAT
GAGATCTTCCACCGGGCGCGATTGGTGAATTGCGGGTTCTTTATGCAGGTCATCTTGGCTG
GTGCGTATATCTATCTTTTCGTTACACAATGCCGCCTCATTCGTACGCTGGATGCGCAG

ACTACGTCGGCGCAATCCTCGGCCTCGTCCGCGACGGGCTACCGTGGCGGCTGGATCCCCTCATGACGATGCGGAGGGAGAGCCACGAGTTCTCGCCGCAGGGAGAGGGCAATGTGGTGT
CGATTGAGTTCAATT
GTGAGTCCTATTGCGGCGCTTGTTTTGAATACATCTTGAGTGTATGCCTGCCTAGTGTTGTACCGATGGCACGCCGCCCTCTCTGCTCAGGACACCAAGTGGACC
GAGGGTCTTTTCAAGAGCGTGTTCGGTCAGGACGTTGACTTTGATAAG
GTGAGCCTCTCGACCCTTTGTAGCGACTGTGCCCATGTTACTCCAACTTGTGCCCGTCATGCTCATTGTTCG
ATCCTTTTACCAGGTCACTCCCACTGACTTCAAGCGCGTCGTCGGACGCATGTTCGGCCAGCCGCAAGACCCGCGCACGGCGACGTTCACTGACTACGCCGGTCAGCGGCTCGAGAGGCA
TCCGGAAGAGGGGGCCGCCACTCCAGATGGTGCCGGCCGTTTTGCGGACGCGGATCTGGCGCGGGTGTTGCAGGACGCAACGAGTTGGCG
GTGAGCCATTGACAGTCCCATCGACAGTGC
GAAAGGCAGGCTGACGTGCTTTGTAGAGCCGGCTCGTACGGTGCTCGCGCTATTCCCGCTGCGCTCCGTGTGATCGAGGTGATGGGTATCGAGCAAAGTAGGGAGTGGGGGACGTGTTCG
GTACGTGGTCGTCGTGCATCTTCCGGCTGGAATTGCATCGTCGACTGGTGCTGACGCAGTGTCTTCCAGCTCAACGAGTTTCGCCACTTCATGGGCTTGAAGAAGTACGACAGCTTCAAG
GACTGGAATCCGGATCCTGTCGTTCACAAGCAAGCCGAGACGTTGTACAAGGACATCAACAACCTTGAGCTACAC
GTAAGCTATCTTCCACATGTCCAGACGTATTGACATGACTGACTT
CGCTTGACCAGGTCGGCATGCAGGCAGAAGCCATCAAGACGCCAGGTCCAGGAGCAGGCCTTTGTCCGGGATACACAATTTCGCGTGCGATTTTGGGCGATGCCGTTGCGCTGACGCGAG
GCGATAGGTTCTTGACAACTGAGTATACTC
GTGAGTGGCTACTTCGATCCCTCGAATCTGTCTGACGCAGCGCTTTGTAGCGAACAATCTGACGCGCTGGGGGTTCAAGTACAGCCATGT
CGATCCGGACGATG
GTAAGGGGTGACCAGATCACCGTCAGTGGGAATATAACTGACGAAGTCGTCAAGGCTCTGTCGGTGGCATCCTTCCGCGCATGCTGCTCGCAACGTTGCCGGACCA
CTATCCCTCGGGAAGCGCATACACCCACTTCCCGTTCCTCGAACCCGCCTACATCCGGAACGAGATGCGCAAGCGAGGAGACAAGAACTTAGACAG
GTGCACCTTGATTGGCGGAGGCGG
GTCGGTCACAGCTAATCGCCGTTTCCCCTAGATATACATGGGATCGCCCTGCCGTCCCTGCGCCCTTGACTGTCATATCGACCTGGGCTGAGGCAGTGGAGGTGCTGGACACGCAGAAGG
CCCGCTTCGTGTCGTCGTACCCGCAGCGACTGAAGGACGTCACGGGTGTGGATGCGGACTCAAAGCTG
GTAGGCTTCATTGGTCTACGGTACTGGGTCCAAAGCTGACGCTCGAGCAGCT
CGCAAGGAAGACCTTGCTGCGGCTCGCGCCACGTTTGCCGGCATACTTCGCGTCCAAGACCATGGAGTTGATCAATGCGAGTCCGGTAACATATGTCGATGCGGATACGAAGACGGTCGA
TATTGGGCGCCATGTTATCAACTTGCTACCGGTGCATTGGATATCGCAGCAGCTC
GTGGGTTGCATCTTGCTCGGTAAATTTCGCGTACTAACCATGCTTCAGGCTTGCATTGCGCTCAA
GACGGAGAGCAACCCATTGGGTACGGAGTACGAGAGCGACGTGTGCGACATGTTCGAGAATGTGTGCAG
GTCAGGCGTCGCCTTTTCAAAGTTGGACGAACTTCAACTGACTCCGCATAG

ATACGTCTACCTCGACAACGACACCTACAACCACTTCCGGCTGCAGACGGACGCCAGGAAAGCGTTCGAGCATCTCACGTCGTTCACCGCCCGCAAACTGCGCGCGATGACTGGCTCGAG
AATATCCGTGTCAGGC
GTGCGTCCGATGCTGCCTTGTTTCTTCTCTTTACTAACCCCGTCGCGTAGATCACTCAAACCCTGTCGCGTTTCATACTCAAGGAAGACGATAGCACGCCTTTC
CTCCGTGCTCTTCTTGAAGGCAGCGATGGCGCCGACGCTGATACCCTTGCGGCACACCTCTTCGCGGAGGTCGTCCCTACGGCGGCGCACTTCTCGCGCATCGTCATGCAGGTCGTGGAC
TTCTTCCTGGGCAGCGACGAGGAGGGCGACGAGAAGAGGCAGGCGAGAGAGGCTATCGTGGCGTTGGCGTCGCAGTGCACGGCGGAGGCGGACAAGCAGGTTATGAAGTATGTGGATGAG
GCGCTGC
GTGAGTGTGCATGTTCGTCGTTGGGTGTGGGTGGCTGACTTGCCTTTCAGGCCTTGAACCGGCGGTATCGGGCGTATACAGAACTGCATCTGCTGCTGCAGTCGTCGGGAACC
AGCGCATTGAGGCGGGTCAGCGCGTGTATGTAGCACTGTCGGCGGCGAAGCAGGAT
GTGAGTGACTTTGTCCTGCGGCTTACGAACTGCTGCTGATCCTGCCCTAGTCATCGGTCTTCGG
CGCAGACACAAGCACTGCTGACTTCAAGAGGAGTACGCCATCGTCGACCCGTCTTGGGCTGCCGGACTCCGG
GTGAGTTATGCGCTGCTATCTGTGAAGAGCTCGACTGAGTTTTTGCCG
TAGCTTGCTGATACCACAGTTATTCGACCGAATATTGCCGCGTGTGCTCGGGGTGATCTTTGGGTTGAAGAACCTTCGTCGCGCGCCTGGGCAGTCGGGAGTGATGAGCAGGTGTGTTGA
TATGTTAGGTGAAGGCCACAGCGGAAGCTAAGACTTAACCTCGCAGCTTCACGCAGACGCTGCACGGTGCGCCCGAGAAGCTGTTCTTTGACTTCGATGGGAACGTTACGCCAATCCCAG
AGTCACTCTTCGTCGAG
GTGAGAGCGCCGTATCCAGCGGCTTGCTGCGCACACTGACGCACACCTGAAGTACGACTTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCATCATTCAGCGCCTCGCTGGCGGCGCCGACTTCGTGCTCGCGAGCACGGCGCCCGTCGACACCGACGGTGGAAAGCCACGACCGCGTTATGTCGTCGGTCAGAAGCTCGATGAG
CTCGTTCAGTACCTGAAGAACCCGCCCGCGCAACTCGACAGTCTGGTGAGCATCAGCATCCCCTACATTCTGGACGCAAAACTGACGAAATGCTCCGAGCCCGCTTACCTCGACGCGGTC
AAGCACATGCATTCTGGCCTTGACGATCGCAAGCTGTTG
CCTGCGCAGTTGGAGCACTTGCTCACCCTCATGGCGCGCCTCGGCAGCGGCAATGACTTTTCGAGCAGGGTCCAAGAGGCG
GTCATTGATTTAC
TCTACAAGGACCTGCCCCACCCTCCGGCATGCTACCTCTCCGTGCTACACCAAGCGGGCCTCAATCTCAACGTCCCGCTCGCGAACGTCAATTACGCCTATCGCACC
GCGGACGGATCCTACTACAACCCTCTCTTTCCTACCCTAGGCATGGCTG
GTACACCATACGCCCGATCGGTGCCCTCAGCGAACTGTACTCCTCTCAATAATCTACCTGACGCCGGCCTT
GTGTTCGATACACTACTTCGACGCAAGGAAGGCACTTTCAAGGAGCACGAAGGCGGGATGTCAAGCCTTTTCTTCGCTATGGCCGACCTAATAATTCATTGTATATTCGATACCGACCAT
AAG
GATATAACGAAGAACAACACGAGCAGCTACCTGGACCTGAGTATCCTCTATGGTAATTCGGAAGAGCAATTGAACGGCGTCCGCCGCCACGATGGCACTGGGCGCCTCTGGGACGAC
GTATTCGCAGACCGCAGACTGCTCCTCATGCCACCGAGCACGTGCGCGCTGCTCGTGCTCTTTTGTCGCAATCATAAT
CACATCGCCCAGCGCATCCTCGATATCAACGAGAAGGGCAAG
TACCGCTCCGTCGACAGCTTCAGCGACGATGCTCGCAAGGCGCAGGACGATGAGATCTTCCACCGGGCGCGATTGGTGAATTGCGGGTTCTTTATGCAGGTCATCTTGGCTG
ACTACGTC
GGCGCAATCCTCGGCCTCGTCCGCGACGGGCTACCGTGGCGGCTGGATCCCCTCATGACGATGCGGAGGGAGAGCCACGAGTTCTCGCCGCAGGGAGAGGGCAATGTGGTGTCGATTGAG
TTCAATT
TGTTGTACCGATGGCACGCCGCCCTCTCTGCTCAGGACACCAAGTGGACCGAGGGTCTTTTCAAGAGCGTGTTCGGTCAGGACGTTGACTTTGATAAGGTCACTCCCACTGAC
TTCAAGCGCGTCGTCGGACGCATGTTCGGCCAGCCGCAAGACCCGCGCACGGCGACGTTCACTGACTACGCCGGTCAGCGGCTCGAGAGGCATCCGGAAGAGGGGGCCGCCACTCCAGAT
GGTGCCGGCCGTTTTGCGGACGCGGATCTGGCGCGGGTGTTGCAGGACGCAACGAGTTGGCG
AGCCGGCTCGTACGGTGCTCGCGCTATTCCCGCTGCGCTCCGTGTGATCGAGGTGATG
GGTATCGAGCAAAGTAGGGAGTGGGGGACGTGTTCG
CTCAACGAGTTTCGCCACTTCATGGGCTTGAAGAAGTACGACAGCTTCAAGGACTGGAATCCGGATCCTGTCGTTCACAAGCAA
GCCGAGACGTTGTACAAGGACATCAACAACCTTGAGCTACAC
GTCGGCATGCAGGCAGAAGCCATCAAGACGCCAGGTCCAGGAGCAGGCCTTTGTCCGGGATACACAATTTCGCGTGCG
ATTTTGGGCGATGCCGTTGCGCTGACGCGAGGCGATAGGTTCTTGACAACTGAGTATACTC
CGAACAATCTGACGCGCTGGGGGTTCAAGTACAGCCATGTCGATCCGGACGATGGCTCT
GTCGGTGGCATCCTTCCGCGCATGCTGCTCGCAACGTTGCCGGACCACTATCCCTCGGGAAGCGCATACACCCACTTCCCGTTCCTCGAACCCGCCTACATCCGGAACGAGATGCGCAAG
CGAGGAGACAAGAACTTAGACAG
ATATACATGGGATCGCCCTGCCGTCCCTGCGCCCTTGACTGTCATATCGACCTGGGCTGAGGCAGTGGAGGTGCTGGACACGCAGAAGGCCCGCTTC
GTGTCGTCGTACCCGCAGCGACTGAAGGACGTCACGGGTGTGGATGCGGACTCAAAGCTG
CTCGCAAGGAAGACCTTGCTGCGGCTCGCGCCACGTTTGCCGGCATACTTCGCGTCCAAG
ACCATGGAGTTGATCAATGCGAGTCCGGTAACATATGTCGATGCGGATACGAAGACGGTCGATATTGGGCGCCATGTTATCAACTTGCTACCGGTGCATTGGATATCGCAGCAGCTC
GCT
TGCATTGCGCTCAAGACGGAGAGCAACCCATTGGGTACGGAGTACGAGAGCGACGTGTGCGACATGTTCGAGAATGTGTGCAG
ATACGTCTACCTCGACAACGACACCTACAACCACTTC
CGGCTGCAGACGGACGCCAGGAAAGCGTTCGAGCATCTCACGTCGTTCACCGCCCGCAAACTGCGCGCGATGACTGGCTCGAGAATATCCGTGTCAGGC
ATCACTCAAACCCTGTCGCGT
TTCATACTCAAGGAAGACGATAGCACGCCTTTCCTCCGTGCTCTTCTTGAAGGCAGCGATGGCGCCGACGCTGATACCCTTGCGGCACACCTCTTCGCGGAGGTCGTCCCTACGGCGGCG
CACTTCTCGCGCATCGTCATGCAGGTCGTGGACTTCTTCCTGGGCAGCGACGAGGAGGGCGACGAGAAGAGGCAGGCGAGAGAGGCTATCGTGGCGTTGGCGTCGCAGTGCACGGCGGAG
GCGGACAAGCAGGTTATGAAGTATGTGGATGAGGCGCTGC
GCCTTGAACCGGCGGTATCGGGCGTATACAGAACTGCATCTGCTGCTGCAGTCGTCGGGAACCAGCGCATTGAGGCGGGT
CAGCGCGTGTATGTAGCACTGTCGGCGGCGAAGCAGGAT
TCATCGGTCTTCGGCGCAGACACAAGCACTGCTGACTTCAAGAGGAGTACGCCATCGTCGACCCGTCTTGGGCTGCCGGAC
TCCGG
CTTGCTGATACCACAGTTATTCGACCGAATATTGCCGCGTGTGCTCGGGGTGATCTTTGGGTTGAAGAACCTTCGTCGCGCGCCTGGGCAGTCGGGAGTGATGAGCAGCTTCACG
CAGACGCTGCACGGTGCGCCCGAGAAGCTGTTCTTTGACTTCGATGGGAACGTTACGCCAATCCCAGAGTCACTCTTCGTCGAG
TACGACTTTTGA

Retrieve as FASTA