Entry information : ScomLDS02
Entry ID 10728
Creation 2012-03-08 (Christophe Dunand)
Last sequence changes 2012-03-08 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-01-04 (Catherine Mathe)
Peroxidase information: ScomLDS02
Name ScomLDS02
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Schizophyllaceae Schizophyllum
Organism Schizophyllum commune    [TaxId: 5334 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ScomLDS02
start..stop
S start..stop
GluxLDS02 1063 0 17..1072 25..1054
LbiLDS02 1029 0 72..1072 49..1018
SlutLDS02 1016 0 6..1073 5..1067
SbreLDS02 1013 0 6..1073 5..1068
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2082384..2082422 39 N° 2 2082473..2082652 180 N° 3 2082709..2082847 139 N° 4 2082897..2083089 193
N° 5 2083139..2083157 19 N° 6 2083210..2083274 65 N° 7 2083335..2083554 220 N° 8 2083608..2083752 145
N° 9 2083804..2083880 77 N° 10 2083932..2083994 63 N° 11 2084045..2084292 248 N° 12 2084340..2084463 124
N° 13 2084512..2084527 16 N° 14 2084578..2085148 571 N° 15 2085205..2085424 220 N° 16 2085480..2085565 86
N° 17 2085615..2085735 121 N° 18 2085804..2086122 319 N° 19 2086198..2086366 169 N° 20 2086419..2086446 28
N° 21 2086498..2086680 183  
join(2082384..2082422,2082473..2082652,2082709..2082847,2082897..2083089,2083139 ..2083157,2083210..2083274,2083335..2083554,2083608..2083752,2083804..2083880,20 83932..2083994,2084045..2084292,2084340..2084463,2084512..2084527,2084578..20851 48,2085205..2085424,2085480..2085565,2085615..2085735,2085804..2086122,2086198.. 2086366,2086419..2086446,2086498..2086680)


exon

Literature and cross-references ScomLDS02
DNA ref. JGI genome:   scaffold_3 (2082384..2086680)
EST ref. GenBank:   GW370191.1 [Fragment]
Cluster/Prediction ref. JGI gene:   1037963
Protein sequence: ScomLDS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1075
PWM (Da):   %s   119921.52  
PI (pH):   %s   6.36
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MESFIRRLSTNDLKTSSNGSANGSAASGSAQPNGSVADTGGNKYTKYVRATEQQPSLFNEQRLFGGYQPPSSVTAVADMMLHKESLDDRKLFLEHGLKFISGTLEGDMQMKAQNTVIKKLYDDLPHPPATALGCEYAWRQPDGSNNNMDLPHLGQAGKPYARSVQQSHPLPSHQLPDPGLIFDTLLKREFVEHPAGLSSLMFGFAALVIHTVFRTNHDDVNINETSSYVDLAPLYGNNQETQDRVRDKSQGRGLLHKDAFAEDRLLLLPPATCAILVCFSRNHFIAERLLEINERGSWQQDLDKLDEEGKAKQDEEIFQIARLVNCGWFGSAVFADYVHCILGLVRQGSSWTLDPFELRKEDHSLFERGKGNVCSVEFNCLYRWHATTSVHDEAWVEKVMTSQFPDKKIEDITPRDFKECAVKLMQHAGPDLTHWTFGNMQRGEDGSFDDEQLADILHNATEQPAGAFRARGTPGVMRLHEIMGIEQNRKWGVCSLNDFRFLGLKAFDTFEDWNPDPEIANAARALYGDIERLELYVGLQAEDAKPVVEGAGLCPGYTISRAILSDAVALTRGDRFFTHDFTPFNLTAWGFADCQRDDMAHGFGSVLARLFLRTLPGQFTEDSVYGFFPLMTPQAMGVVLKRLGKEADYSLARPEPAATEKVVTTHDGVRAVLTSDAYVSPTGTRARKVRGKDGMTFPLVLTGREQQAQICKVFQAPEIAAGVADYFKTTTRHLLDLHGCPLPGTRHYVIDVVRDVLKPLPALWAANEAGIQLKETKDGEGVYTVEEFYSMLSETYEFIFLDIEASRYKTVECRVRKHVEELIGHITSHLNNTFPQVISTIMSKMPWAKGSKKSEHDELVRRLQLLAPSSSALADTILAIIISVVDISLGLTNVVNAYLGPHKVTEPVPPHVDAFIKAAKPEQLEGFILEALRHDPPTRCMQRTAVSGHVVENIRVEAGARLFLDLEQANKDEAVFSSPDEHRIGRPKEKHLFGEGSITILGQDMVHIYAEVLTVIFSHPNVRRTVGQSGMLQRFKTVERKALNYAYLDAKMMVSPWPSSMMIQYDV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (20 introns) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTCCTTTATCAGGAGGTTGTCGACGAACGACCTGGTGAGTCGGAGTCCTTGATCCTGTTGGGAAGCCTAATGACATGTCGGCAGAAAACTAGCAGCAATGGCTCGGCGAACGGTA
GCGCTGCTAGCGGAAGCGCTCAGCCCAACGGGTCTGTCGCCGATACTGGTGGCAACAAGTACACCAAGTATGTCCGTGCCACTGAGCAGCAGCCGTCGCTCTTCAACGAGCAACGGCTCT
TCGGCGGGTATCAGCCGCCCAGCAGCGTT
GTGCGTCCAGTTCGACAACTCACTTCATTTGCGTCTCATGGATGCCTTTAATCTAGACGGCTGTCGCGGACATGATGCTGCACAAGGAGAG
CCTCGATGACCGGAAGTTGTTCCTCGAGCATGGGCTCAAGTTCATCTCGGGCACGCTCGAGGGAGATATGCAGATGAAAGCTCAGAACACGGTCATCAAGAAGC
GTGAGTGGTTTGCCTG
TCACCGCGAGGGTGTCTGCTCATTCTGCGACAGTGTACGACGACCTTCCGCACCCGCCTGCGACTGCTCTTGGTTGCGAGTACGCGTGGCGCCAACCGGATGGCTCAAATAACAATATGG
ACCTGCCCCACCTCGGTCAGGCGGGCAAGCCGTACGCGCGCAGTGTCCAGCAGTCGCATCCCCTTCCTTCGCACCAGCTGCCTGACCCCGGCCTCATCTTCGACAC
GTAAGTTGCGCCCC
TAGACTCATCCCGGCCCCAGCTGACCCTCCCTTAGCCTGCTCAAGCGCGAGAAGGTGCCGTCAATCCGTCTGTCATTAGCCCTGCCGCCACTGACCATGCCCCAAGTTCGTCGAGCACCC
CGCCGGCCTCTCGTCCCTCATGTTCGGCTTCGCGGCGCTGGTTATCCACAC
GTAAGTCTTCGCGGCAGGTGACGATGGGCGCGGACAGCAGCTGACCGCGATGCGCGATAGGGTTTTCCG
CACTAACCACGACGACGTGAACATCAACGAGACGTCGTCGTACGTCGACCTGGCGCCGCTCTACGGCAACAACCAGGAGACGCAGGACAGGGTGCGCGATAAGAGCCAGGGGCGCGGCTT
GCTGCACAAGGATGCGTTTGCGGAGGATCGGTTGCTGCTCCTCCCACCTGCGACGTGCGCGATCCTGGTGTGCTTTAGCAGGAACCACAAC
GTGCGTCGAGTTCTCTCGACTGCGCATAC
TTCGCGTGCTCACCTTCCGCATAGTTCATCGCCGAGAGACTTCTCGAGATCAACGAGAGGGGATCCTGGCAGCAAGACCTTGACAAGCTGGACGAGGAGGGCAAGGCTAAGCAGGATGAG
GAGATCTTCCAGATCGCAAGACTCGTCAACTGTGGTTGGTTTGGCTCTG
GTAAGCACTGCCTTGTCACTTTGTGTTGACAGTATTTGATATTCTTCGCAGCTGTTTTCGCGGACTACGTT
CACTGCATTCTCGGCCTGGTTCGTCAGGGGAGTAGCTGGACGCTTGACCCCTTTAGC
GTAAGTTCAATACTTTGGCTGACGACCATGATGCTCAAAACAATCATATAGGAACTGCGCAAG
GAGGACCACTCGCTCTTCGAGCGCGGCAAGGGCAATGTCTGCTCCGTCGAG
GTATGCCTAATCTCCACTCACAATGTCTTTCCCACTCAATGCAATCACAGTTCAACTGCCTCTACCGCT
GGCACGCGACGACTAGCGTCCACGATGAGGCCTGGGTCGAGAAGGTTATGACGAGCCAGTTCCCGGACAAGAAGATAGAGGACATCACGCCACGGGACTTCAAGGAATGCGCCGTCAAGC
TGATGCAACACGCCGGCCCTGACCTTACGCACTGGACCTTCGGCAACATGCAGCGCGGCGAGGATGGATCCTTCGACGATGAGCAGCTCGCTGACATCTTGCACAACGC
GTGAGTGGGTT
GCAAAACCGAGCGAATAGTGCTAACGAACGAGATAGGACGGAGCAGCCTGCTGGTGCTTTCAGGGCGCGGGGCACGCCGGGCGTTATGCGTCTGCATGAGATCATGGGCATCGAGCAGAA
CAGGAAGTGGGGCGTCTGCTCTTTGAACGACTTCCGTCGG
GTACGTCCTTGCTCTCCGGAAGTGAGGCTATGACTGACCAATCTTAAGTTCTTGGGCCTGAAGGGTACGGAGTGGCGTCA
TGTCCGAAAACCCATGTACTAACCTCTTCCATAGCGTTTGACACGTTCGAGGACTGGAACCCCGACCCTGAGATCGCCAATGCCGCCAGAGCCCTCTACGGCGACATCGAGCGCCTCGAG
CTCTACGTCGGTCTCCAAGCCGAAGACGCCAAGCCCGTCGTCGAGGGCGCCGGCCTCTGCCCCGGCTACACCATCTCGCGCGCGATCCTCAGCGACGCCGTCGCGCTCACGCGCGGCGAC
CGCTTCTTCACGCACGACTTCACGCCCTTCAACCTCACCGCCTGGGGCTTCGCGGACTGCCAGCGCGACGACATGGCGCACGGGTTCGGTTCGGTGCTCGCTAGGCTCTTCCTGCGCACG
CTGCCGGGGCAGTTCACGGAAGACAGCGTGTACGGGTTCTTCCCGCTGATGACGCCGCAGGCGATGGGCGTGGTGCTGAAGCGGCTGGGGAAGGAGGCGGATTATAGTCTGGCGCGCCCG
GAGCCGGCGGCGACTGAAAAGGTGGTAACGACGCATGATGGGGTGCGCGCGGTGCTGACGAGCGATGCGTATGTGAGCCCGACGGGGACGCGTGCTCGCAAAGTGCGGGGCAAGGATGGC
ATGAC
GTGAGTGTGCTGCTTGCTGCTTTGGCTAGAAATGTTTGCTGACGATGTTGGGATAGGTTCCCGCTCGTCCTTACCGGCAGAGAGCAGCAGGCGCAGATCTGCAAGGTCTTCCAAG
CACCTGAGATCGCTGCCGGCGTCGCCGACTACTTCAAGACCACGACGAGGCATCTGCTGGACCTGCACGGCTGCCCGCTTCCTGGCACGCGCCACTATGTCATCGACGTCGTCCGCGACG
TGCTTAAGCCCCTCCCGGCGCTTTGGGCTGCGAACGAACTG
GTGAGGGAGTCAATCTTATCACTGTATGAACCGTTCGCTGACACTTCGATTCAAGGCGGGCATCCAGCTGAAGGAGACC
AAGGATGGCGAAGGCGTCTACACGGTCGAAGAGTTTTACAGTATGCTGTCCGAGACTTACGA
GTACGACTTCTCTCTCGTTCGTGGTGATTGCAAAGCTAACGCATGACAGGTTCATCTT
CCTCGACATCGAGGCTTCCCGCTACAAGACCGTCGAGTGCCGCGTCCGCAAGCACGTCGAGGAGCTCATTGGGCACATCACGAGCCACCTGAACAACACGTTCCCGCAGAAG
GTATGCGG
CTCTCAACTCAACGGCAACGCTTGTTGCATGTTGCCTCACAGCTAACCCAGATCAAAAAGGTCATCAGCACTATCATGTCGAAGATGCCGTGGGCGAAGGGGTCGAAGAAGTCCGAGCAC
GACGAGCTGGTGCGCCGCCTGCAGCTGCTCGCGCCGTCGTCGTCCGCGCTGGCAGATACGATCCTCGCCATCATCATCTCCGTCGTCGACATCTCGCTGGGCCTGACGAACGTCGTCAAC
GCGTACCTCGGCCCGCACAAAGTCACCGAGCCCGTCCCGCCGCACGTCGATGCGTTCATTAAGGCGGCGAAGCCCGAGCAGCTCGAGGGCTTCATCTTGGAGGCCCTGCGACACGACCCG
CCGACGCGGTGCATGCAGC
GTGCGTGTTTTTCATTTGCATAATCGCTGCTTGCCCGTACCGATCGCCTCGACTGACGGCTGACCTCCTCCACAGGCACCGCTGTATCGGGCCACGTCGTC
GAGAACATCCGCGTCGAGGCCGGCGCGCGCCTGTTCCTCGACCTCGAGCAGGCGAACAAGGACGAGGCCGTGTTCTCGTCGCCGGATGAGCACAGGATCGGGAGACCCAAGGAGAAGCAC
TTGTTTGGCGAAGGGTCTATCAC
GTATGTGCCAGATGATATGTGTTGGAGTGTGATACTAACGTGGTTTCGACAGGATCCTCGGGCAGGATATGGTGCACAAGGTATGTTTTATCCCATT
GATAATGGTGGACATCGAGTTGACTGTGATTTAGATCTACGCTGAGGTCCTCACCGTGATCTTCAGCCACCCCAACGTCCGCCGCACGGTCGGGCAGTCTGGCATGTTGCAGAGGTTCAA
GACCGTCGAGCGCAAGGCCCTGAACTACGCTTACCTCGACGCGAAGATGATGGTGTCGCCGTGGCCATCCTCGATGATGATTCAGTACGATGTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTCCTTTATCAGGAGGTTGTCGACGAACGACCTGAAAACTAGCAGCAATGGCTCGGCGAACGGTAGCGCTGCTAGCGGAAGCGCTCAGCCCAACGGGTCTGTCGCCGATACTGGT
GGCAACAAGTACACCAAGTATGTCCGTGCCACTGAGCAGCAGCCGTCGCTCTTCAACGAGCAACGGCTCTTCGGCGGGTATCAGCCGCCCAGCAGCGTT
ACGGCTGTCGCGGACATGATG
CTGCACAAGGAGAGCCTCGATGACCGGAAGTTGTTCCTCGAGCATGGGCTCAAGTTCATCTCGGGCACGCTCGAGGGAGATATGCAGATGAAAGCTCAGAACACGGTCATCAAGAAGC
TG
TACGACGACCTTCCGCACCCGCCTGCGACTGCTCTTGGTTGCGAGTACGCGTGGCGCCAACCGGATGGCTCAAATAACAATATGGACCTGCCCCACCTCGGTCAGGCGGGCAAGCCGTAC
GCGCGCAGTGTCCAGCAGTCGCATCCCCTTCCTTCGCACCAGCTGCCTGACCCCGGCCTCATCTTCGACAC
CCTGCTCAAGCGCGAGAAGTTCGTCGAGCACCCCGCCGGCCTCTCGTCC
CTCATGTTCGGCTTCGCGGCGCTGGTTATCCACAC
GGTTTTCCGCACTAACCACGACGACGTGAACATCAACGAGACGTCGTCGTACGTCGACCTGGCGCCGCTCTACGGCAACAACCAG
GAGACGCAGGACAGGGTGCGCGATAAGAGCCAGGGGCGCGGCTTGCTGCACAAGGATGCGTTTGCGGAGGATCGGTTGCTGCTCCTCCCACCTGCGACGTGCGCGATCCTGGTGTGCTTT
AGCAGGAACCACAAC
TTCATCGCCGAGAGACTTCTCGAGATCAACGAGAGGGGATCCTGGCAGCAAGACCTTGACAAGCTGGACGAGGAGGGCAAGGCTAAGCAGGATGAGGAGATCTTC
CAGATCGCAAGACTCGTCAACTGTGGTTGGTTTGGCTCTG
CTGTTTTCGCGGACTACGTTCACTGCATTCTCGGCCTGGTTCGTCAGGGGAGTAGCTGGACGCTTGACCCCTTTAGCGAA
CTGCGCAAGGAGGACCACTCGCTCTTCGAGCGCGGCAAGGGCAATGTCTGCTCCGTCGAG
TTCAACTGCCTCTACCGCTGGCACGCGACGACTAGCGTCCACGATGAGGCCTGGGTCGAG
AAGGTTATGACGAGCCAGTTCCCGGACAAGAAGATAGAGGACATCACGCCACGGGACTTCAAGGAATGCGCCGTCAAGCTGATGCAACACGCCGGCCCTGACCTTACGCACTGGACCTTC
GGCAACATGCAGCGCGGCGAGGATGGATCCTTCGACGATGAGCAGCTCGCTGACATCTTGCACAACGC
GACGGAGCAGCCTGCTGGTGCTTTCAGGGCGCGGGGCACGCCGGGCGTTATG
CGTCTGCATGAGATCATGGGCATCGAGCAGAACAGGAAGTGGGGCGTCTGCTCTTTGAACGACTTCCGTCGG
TTCTTGGGCCTGAAGGCGTTTGACACGTTCGAGGACTGGAACCCCGAC
CCTGAGATCGCCAATGCCGCCAGAGCCCTCTACGGCGACATCGAGCGCCTCGAGCTCTACGTCGGTCTCCAAGCCGAAGACGCCAAGCCCGTCGTCGAGGGCGCCGGCCTCTGCCCCGGC
TACACCATCTCGCGCGCGATCCTCAGCGACGCCGTCGCGCTCACGCGCGGCGACCGCTTCTTCACGCACGACTTCACGCCCTTCAACCTCACCGCCTGGGGCTTCGCGGACTGCCAGCGC
GACGACATGGCGCACGGGTTCGGTTCGGTGCTCGCTAGGCTCTTCCTGCGCACGCTGCCGGGGCAGTTCACGGAAGACAGCGTGTACGGGTTCTTCCCGCTGATGACGCCGCAGGCGATG
GGCGTGGTGCTGAAGCGGCTGGGGAAGGAGGCGGATTATAGTCTGGCGCGCCCGGAGCCGGCGGCGACTGAAAAGGTGGTAACGACGCATGATGGGGTGCGCGCGGTGCTGACGAGCGAT
GCGTATGTGAGCCCGACGGGGACGCGTGCTCGCAAAGTGCGGGGCAAGGATGGCATGAC
GTTCCCGCTCGTCCTTACCGGCAGAGAGCAGCAGGCGCAGATCTGCAAGGTCTTCCAAGCA
CCTGAGATCGCTGCCGGCGTCGCCGACTACTTCAAGACCACGACGAGGCATCTGCTGGACCTGCACGGCTGCCCGCTTCCTGGCACGCGCCACTATGTCATCGACGTCGTCCGCGACGTG
CTTAAGCCCCTCCCGGCGCTTTGGGCTGCGAACGAACTG
GCGGGCATCCAGCTGAAGGAGACCAAGGATGGCGAAGGCGTCTACACGGTCGAAGAGTTTTACAGTATGCTGTCCGAGACT
TACGA
GTTCATCTTCCTCGACATCGAGGCTTCCCGCTACAAGACCGTCGAGTGCCGCGTCCGCAAGCACGTCGAGGAGCTCATTGGGCACATCACGAGCCACCTGAACAACACGTTCCCG
CAGAAG
GTCATCAGCACTATCATGTCGAAGATGCCGTGGGCGAAGGGGTCGAAGAAGTCCGAGCACGACGAGCTGGTGCGCCGCCTGCAGCTGCTCGCGCCGTCGTCGTCCGCGCTGGCA
GATACGATCCTCGCCATCATCATCTCCGTCGTCGACATCTCGCTGGGCCTGACGAACGTCGTCAACGCGTACCTCGGCCCGCACAAAGTCACCGAGCCCGTCCCGCCGCACGTCGATGCG
TTCATTAAGGCGGCGAAGCCCGAGCAGCTCGAGGGCTTCATCTTGGAGGCCCTGCGACACGACCCGCCGACGCGGTGCATGCAGC
GCACCGCTGTATCGGGCCACGTCGTCGAGAACATC
CGCGTCGAGGCCGGCGCGCGCCTGTTCCTCGACCTCGAGCAGGCGAACAAGGACGAGGCCGTGTTCTCGTCGCCGGATGAGCACAGGATCGGGAGACCCAAGGAGAAGCACTTGTTTGGC
GAAGGGTCTATCAC
GATCCTCGGGCAGGATATGGTGCACAAGATCTACGCTGAGGTCCTCACCGTGATCTTCAGCCACCCCAACGTCCGCCGCACGGTCGGGCAGTCTGGCATGTTGCAG
AGGTTCAAGACCGTCGAGCGCAAGGCCCTGAACTACGCTTACCTCGACGCGAAGATGATGGTGTCGCCGTGGCCATCCTCGATGATGATTCAGTACGATGTTTGA

Retrieve as FASTA