Entry information : JargLDS01
Entry ID 10729
Creation 2012-03-08 (Christophe Dunand)
Last sequence changes 2012-03-08 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-11 (Catherine Mathe)
Peroxidase information: JargLDS01
Name JargLDS01
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Jaapiaceae Jaapia
Organism Jaapia argillacea    [TaxId: 202697 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value JargLDS01
start..stop
S start..stop
PplLDS01-1 1122 0 5..1067 7..1005
PplLDS01-2 1102 0 5..1066 7..1004
LbiLDS01 1086 0 1..1068 1..1071
ScomLDS01 1030 0 5..1067 3..1109
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 415422..415592 171 N° 2 415648..415710 63 N° 3 415768..415852 85 N° 4 415908..416440 533
N° 5 416500..416718 219 N° 6 416781..416945 165 N° 7 417001..417080 80 N° 8 417141..417312 172
N° 9 417366..417399 34 N° 10 417449..417492 44 N° 11 417552..417738 187 N° 12 417793..418151 359
N° 13 418204..418383 180 N° 14 418440..418525 86 N° 15 418579..418699 121 N° 16 418756..419053 298
N° 17 419104..419117 14 N° 18 419171..419278 108 N° 19 419330..419409 80 N° 20 419462..419489 28
N° 21 419542..419621 80 N° 22 419676..419766 91 N° 23 419826..419837 12  
join(415422..415592,415648..415710,415768..415852,415908..416440,416500..416718, 416781..416945,417001..417080,417141..417312,417366..417399,417449..417492,41755 2..417738,417793..418151,418204..418383,418440..418525,418579..418699,418756..41 9053,419104..419117,419171..419278,419330..419409,419462..419489,419542..419621, 419676..419766,419826..419837)


exon

Literature and cross-references JargLDS01
DNA ref. JGI genome:   scaffold_29 (415422..419837)
Cluster/Prediction ref. JGI gene:   162433
Protein sequence: JargLDS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1070
PWM (Da):   %s   117576.92  
PI (pH):   %s   5.67
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATKILRTISNAAEYVSDSKAPVDEDGGYPIPPEISVDINELEGWLKTGPPFSIKDIPAYVDAVKNLNSVGINDRKFFLEKLLTLMARLGDGNEFSTQLQHFVIDALYKDLPHPPSSYLSLASAPTPVSAPLGVPYAYRPADGSNYNPLFPTLGQAGAPYARSVPSSNFTPQRSLPDAGLLFDTLLKRDKFTPHPGGISSLFFAFADLIIHSIFNTNPRDWTKNEVSSYLDLSVLYGSSDKDVASVRKSDGTGKIWEDSFADPRLLFMPPSVCALLVIFSRNHYVAEKLLAINEKGTYKDPASLSGDALAAQDEEIFQRTRLVNSGFFVQAIFADYVGAILGLVRDGLTWRLNPLDTMRQLDHEFSPQGEGNVVSLEFNLLYRWHATTSQQDTKWTEDLFQEVFSGKDFSTITVDDFKTIAVQKMIPKTPPKEWTFDGLTRDEKTGKFSDAALAKILQDATEWSASAFKARGTPEVLRVIEIMGIEQSRSWGACLNEFRKFMGLKEYDNFAEWNPDPVIKAAEALYGHIDNLELHVGMQAEEAKVPMPGAGLCPGYTISRAILADAVCLTRGDRFLTVDNTPFNLTSWGYQDCQIDKNDGSFGGMLTKMLFRHLPDYYPRNSTYAFFPFLVPSSMKGFAEKLGDGTVNKYSWTRPTAPAPTIKVETFEGVSWVLTSPQNFLPQSRTRMEILSKGAAANRKVDGTLFNNSQIAKWRSSFRQTTLGLIKDKSVSHVGSTARYVDVVKDVVNLVPIHWIANEVVGVSMKTTANPSGISREQDLYNKFADVCNYIFLNYDPYHDLELHNDAAKTIAEIAGTLKSHLERLKDGFSISGLVDTTKHFWTGANDHSDAFLKSLLSANKNANLDDLAKALVLEVVGTAALYSKAIAHVIDFYLDQDAACKDILQLATVNTTASDAKLSSYIREALRLKPVSGVYSVAQHDATVGPQTKVSKGTNVYASVIKADLDPSVFGPDPTTPNFTRPVAGLLGLEDYGLLTSSFFETASEVLIAVLTLKSVARAPGYSGIFNTFTQDQSGSKEVLYINPGGVVTPWPSSLVLYTA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (22 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACCAAGATATTAAGAACCATTAGCAATGCTGCAGAGTATGTCAGCGATAGCAAGGCGCCCGTGGACGAGGACGGGGGCTATCCCATCCCTCCCGAAATTTCGGTGGACATCAAC
GAACTCGAGGGGTGGCTCAAGACTGGCCCTCCCTTCTCTATCAAGGATATC
GTCAGTGTCGTCATCGCCGTTCTCTTGCTCGACGTCTGATTATCTATCCCTCTAGCCTGCCTATGTTGA
TGCCGTGAAGAATTTGAACAGCGTTGGGATCAATGATCGTAAATTCTTT
GTGAGTAGCTTTGTGTAGGTGGCATGCCACGGCGGTCGCCAACTGATTTCGCCATAGCTCGAGAAACTCTT
GACTCTCATGGCGCGTCTTGGCGATGGGAATGAGTTCTCCACACAGCTCCAACATTTTGTGATCGATGCTT
GTGAGTCGGTTTCCTGTCTCTGTGCAAGCCCACATATCAATTCATATCG
CGCAAGTGTACAAGGACTTGCCCCATCCTCCAAGCAGCTACCTTTCTCTTGCCTCTGCGCCGACACCTGTCTCCGCTCCGCTCGGTGTTCCATATGCCTACCGTCCTGCTGATGGTTCCA
ACTACAACCCTCTCTTCCCAACTCTTGGCCAAGCAGGCGCTCCTTATGCACGCTCTGTGCCTTCGTCCAACTTCACTCCCCAACGCTCCTTGCCCGACGCTGGCCTCCTCTTCGACACCC
TCCTTAAACGCGACAAATTCACTCCCCATCCCGGAGGAATTTCCAGCTTGTTTTTCGCTTTCGCCGATTTGATCATCCATAGCATCTTCAACACCAACCCCCGAGATTGGACGAAGAATG
AAGTCAGCAGTTATTTGGATTTGAGTGTATTATACGGGAGCTCAGATAAAGATGTGGCGAGCGTGAGGAAGAGCGATGGAACCGGCAAGATATGGGAAGATTCATTCGCTGATCCCAGAT
TGCTGTTCATGCCACCGTCTGTGTGCGCTCTCTTGGTGATTTTCAGTCGTAACCACAAC
GTGAGTTTATTTACCTCCTTTCTTCGGATATTCGTTCCTGACGGTTTATTTTGGAACAGTA
CGTGGCGGAGAAGCTCTTGGCCATCAACGAGAAGGGAACATACAAAGATCCTGCCTCCTTGAGTGGTGATGCTCTCGCAGCCCAAGACGAGGAAATTTTCCAGCGCACCAGACTCGTTAA
CAGCGGATTCTTCGTGCAAGCCATCTTCGCTGATTACGTCGGTGCTATCTTGGGTCTTGTCAGAGATGGCTTGACATGGAGATTAAACCCTCTGGAT
GTAAGTGCAATCCAACAATGTTC
TCACACCACACCCGAGCTAATCGTTTCTGATATGCATAGACGATGCGTCAACTTGATCACGAATTCAGCCCTCAAGGAGAAGGAAATGTTGTCTCGCTCGAGTTTAACTTGCTTTACAGG
TGGCATGCTACCACTTCCCAGCAGGATACCAAGTGGACTGAGGACCTCTTCCAGGAGGTTTTCAGTGGAAAGGACTTCAGCACG
GTATGTCTCCTTTGCCGTTGTACCGAGTAGTTGCTG
ACGTCATCGAGGTGGATAGATCACTGTGGATGATTTCAAGACTATTGCTGTCCAGAAGATGATTCCTAAGACTCCTCCGAAGGAGTGGACTTTCGATGGGTTAGCCTATGCTGTCGTACT
CCCGTCGTGATTGCTTGTGTCTGATGATCTCTCTCATAGCCTGACGCGAGACGAGAAGACGGGCAAGTTCTCTGATGCGGCCCTTGCCAAGATTCTACAAGACGCCACAGAGTGGTCTGC
TAGTGCGTTCAAGGCTCGGGGGACTCCGGAGGTTTTGAGAGTCATTGAGATTATGGGAATCGAACAATCTAGGAGTTGGGGTGCTTGCTCT
GTACGTCGGTCGCCATCACAGTTTTGACC
CTGGCTTACATGGTCACGTCGTAGTTGAACGAATTCAGGAAATTTATGGGTTTGAAAGGTCGGTCCAAGGTCTCCAGGGAGTATGTCAAGGCTGACCAATATGATAGAGTACGATAACTT
CGCGGAGTGGAATCCTGATCCTGTTATCAAC
GTACGTCGCCATAGTTTTGATCCTATCCCTTCCTCACGAACGTTCTCCGACTACGATAGAAAGCGGCTGAAGCCCTGTACGGACATATC
GACAACCTTGAGTTGCACGTCGGTATGCAAGCCGAAGAAGCGAAGGTTCCCATGCCTGGAGCCGGTCTTTGCCCTGGTTATACCATCTCCAGAGCTATCCTCGCAGATGCTGTTTGTTTG
ACTCGTGGCGATAGATTCTTGACTGTCGACAATACTC
GTGGGTTTCCCTTACTACTGCGATGGCTATCTTTTTACCTACCCTTCTACTTAGCCTTCAACTTGACCTCTTGGGGTTATCAA
GACTGTCAAATTGACAAGAATGATGGGTCTTTCGGGGGAATGCTCACCAAGATGCTCTTCCGCCATCTCCCAGATTACTATCCTCGCAATTCAACCTACGCGTTCTTCCCGTTCTTGGTT
CCGTCTTCCATGAAGGGCTTTGCCGAAAAGTTGGGAGACGGCACTGTCAATAAGTACTCCTGGACGAGGCCCACTGCCCCAGCCCCTACCATCAAGGTCGAGACATTCGAGGGTGTTTCG
TGGGTGCTGACGAGTCCCCAGAACTTTTTGCCCCAGTCTCGCACCAGAATGGAGATTTTATCAAAAGGTGCTGCTGCAAACCGCAAGCTC
GTATGTCGACATTTTCTCTTGCGCGATTTA
TTGCTAACATGTTGTTGCTTAGGTGGACGGCACATTATTTAACAATAGCCAAATCGCCAAGTGGCGATCATCGTTTAGGCAAACGACTTTGGGGTTGATCAAAGACAAGAGTGTCAGCCA
TGTCGGGTCGACTGCTCGTTATGTGGATGTAGTCAAGGACGTCGTCAATCTCGTTCCCATCCACTGGATCGCAAATGAAGTA
GTGGGTATCATTGAGTTCTTGCTGGTCTTCTGCCTCGC
CTGATGCAGATTGGTTAGGTTGGAGTTTCGATGAAGACCACTGCAAACCCGTCTGGGATTTCCAGGGAGCAAGATTTGTACAACAAGTTTGCCGATGTCTGCAAGTGGGTAATTTCTTTC
CTTGGACTAGGTTTGCTTCTCACGCGATGTTCATCAGCTATATATTCCTCAATTATGATCCTTATCATGACCTCGAACTCCATAACGATGCTGCTAAGACAATTGCTGAAATTGCGGGGA
CCCTCAAGTCGCACCTCGAGAGATTGAAGGATGGCCTG
GTGGGTGATATCTGCTGCCTTCTAATACTTTCGCTGACTGAATACTGCCATGCAAGTTCTCTATCAGTGGCCTAGTGGACAC
GACGAAGCACTTCTGGACCGGCGCTAACGACCACAGTGATGCCTTTTTGAAGTCATTGCTTTCGGCCAACAAGAACGCAAATTTGGACGATTTGGCCAAAGCTTTGGTGTTGGAGGTTGT
TGGGACGGCTGCTCTCTACTCCAAGGCCATCGCCCACGTCATCGATTTTTATCTGGACCAAGACGCAGCCTGCAAAGATATCCTCCAGCTCGCGACTGTGAATACCACAGCCTCGGACGC
AAAGCTTTCCAGCTACATTCGCGAGGCGCTTC
GTGAGTCTTATCGTTTCGTGATCGGGGACCAACTGCTGAGTGTTGCTTAGGTCTCAAGCCGGTGGCACGTGTCATGCATATTGGATTG
TCGGGAGACGACTGATCTTTATTGTACAGGTTTCAGGAGTCTATTCCGTAGCGCAACACGATGCCACGGTTGGCCCTCAAACTAAGGTCTCAAAGGGCACGAACGTCTATGCAAGTGTCA
TCAAGGCGGACCTTGAT
GTGAGCTTCGTCTGTCGCTGGACTCCATGATCGGAGCTGACAACTTGACAGCCCAGTGTCTTTGGACCTGACCCCACAACCCCCAACTTCACGCGACCCGTCG
CAGGTTTGCTAGGTTTGGAGGACTACGG
GTGCGAAAGTTGTTCTCCAACCCTGCTATCTTTTGCTCATTTCTCGTTCCAGCCTTCTCACATCTTCTTTCTTCGAGAAGGTGAATATCGCA
GTGAATTGTATCTTATTCTCATCCTAACCTTCCGATAAAGACTGCATCCGAAGTGCTCATCGCCGTCTTGACTTTGAAGTCCGTGGCAAGGGCGCCTGGCTACTCCGGAATCTTCAATAC
GTATGTGTTGAAATTTTCTTTGCTTGGGTGATAACGTTCAGATGAGCTTCTCAGGTTTACACAAGATCAAAGCGGTTCGAAGGAAGTTTTGTATATCAACCCAGGTGGTGTGGTGACTCC
TTGGCCCTCGTCACTGGTGTTGCAG
GTGTGTTATCCCGTGGTTTTACTGTGTCGTCCTCCACTGAAAGCCATCCTGTTTGACAGTACACCGCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACCAAGATATTAAGAACCATTAGCAATGCTGCAGAGTATGTCAGCGATAGCAAGGCGCCCGTGGACGAGGACGGGGGCTATCCCATCCCTCCCGAAATTTCGGTGGACATCAAC
GAACTCGAGGGGTGGCTCAAGACTGGCCCTCCCTTCTCTATCAAGGATATC
CCTGCCTATGTTGATGCCGTGAAGAATTTGAACAGCGTTGGGATCAATGATCGTAAATTCTTTCTCGAG
AAACTCTTGACTCTCATGGCGCGTCTTGGCGATGGGAATGAGTTCTCCACACAGCTCCAACATTTTGTGATCGATGCTT
TGTACAAGGACTTGCCCCATCCTCCAAGCAGCTACCTTTCT
CTTGCCTCTGCGCCGACACCTGTCTCCGCTCCGCTCGGTGTTCCATATGCCTACCGTCCTGCTGATGGTTCCAACTACAACCCTCTCTTCCCAACTCTTGGCCAAGCAGGCGCTCCTTAT
GCACGCTCTGTGCCTTCGTCCAACTTCACTCCCCAACGCTCCTTGCCCGACGCTGGCCTCCTCTTCGACACCCTCCTTAAACGCGACAAATTCACTCCCCATCCCGGAGGAATTTCCAGC
TTGTTTTTCGCTTTCGCCGATTTGATCATCCATAGCATCTTCAACACCAACCCCCGAGATTGGACGAAGAATGAAGTCAGCAGTTATTTGGATTTGAGTGTATTATACGGGAGCTCAGAT
AAAGATGTGGCGAGCGTGAGGAAGAGCGATGGAACCGGCAAGATATGGGAAGATTCATTCGCTGATCCCAGATTGCTGTTCATGCCACCGTCTGTGTGCGCTCTCTTGGTGATTTTCAGT
CGTAACCACAAC
TACGTGGCGGAGAAGCTCTTGGCCATCAACGAGAAGGGAACATACAAAGATCCTGCCTCCTTGAGTGGTGATGCTCTCGCAGCCCAAGACGAGGAAATTTTCCAGCGC
ACCAGACTCGTTAACAGCGGATTCTTCGTGCAAGCCATCTTCGCTGATTACGTCGGTGCTATCTTGGGTCTTGTCAGAGATGGCTTGACATGGAGATTAAACCCTCTGGAT
ACGATGCGT
CAACTTGATCACGAATTCAGCCCTCAAGGAGAAGGAAATGTTGTCTCGCTCGAGTTTAACTTGCTTTACAGGTGGCATGCTACCACTTCCCAGCAGGATACCAAGTGGACTGAGGACCTC
TTCCAGGAGGTTTTCAGTGGAAAGGACTTCAGCACG
ATCACTGTGGATGATTTCAAGACTATTGCTGTCCAGAAGATGATTCCTAAGACTCCTCCGAAGGAGTGGACTTTCGATGGCCTG
ACGCGAGACGAGAAGACGGGCAAGTTCTCTGATGCGGCCCTTGCCAAGATTCTACAAGACGCCACAGAGTGGTCTGCTAGTGCGTTCAAGGCTCGGGGGACTCCGGAGGTTTTGAGAGTC
ATTGAGATTATGGGAATCGAACAATCTAGGAGTTGGGGTGCTTGCTCT
TTGAACGAATTCAGGAAATTTATGGGTTTGAAAGAGTACGATAACTTCGCGGAGTGGAATCCTGATCCTGTT
ATCAAC
AAAGCGGCTGAAGCCCTGTACGGACATATCGACAACCTTGAGTTGCACGTCGGTATGCAAGCCGAAGAAGCGAAGGTTCCCATGCCTGGAGCCGGTCTTTGCCCTGGTTATACC
ATCTCCAGAGCTATCCTCGCAGATGCTGTTTGTTTGACTCGTGGCGATAGATTCTTGACTGTCGACAATACTC
CCTTCAACTTGACCTCTTGGGGTTATCAAGACTGTCAAATTGACAAG
AATGATGGGTCTTTCGGGGGAATGCTCACCAAGATGCTCTTCCGCCATCTCCCAGATTACTATCCTCGCAATTCAACCTACGCGTTCTTCCCGTTCTTGGTTCCGTCTTCCATGAAGGGC
TTTGCCGAAAAGTTGGGAGACGGCACTGTCAATAAGTACTCCTGGACGAGGCCCACTGCCCCAGCCCCTACCATCAAGGTCGAGACATTCGAGGGTGTTTCGTGGGTGCTGACGAGTCCC
CAGAACTTTTTGCCCCAGTCTCGCACCAGAATGGAGATTTTATCAAAAGGTGCTGCTGCAAACCGCAAGCTC
GTGGACGGCACATTATTTAACAATAGCCAAATCGCCAAGTGGCGATCA
TCGTTTAGGCAAACGACTTTGGGGTTGATCAAAGACAAGAGTGTCAGCCATGTCGGGTCGACTGCTCGTTATGTGGATGTAGTCAAGGACGTCGTCAATCTCGTTCCCATCCACTGGATC
GCAAATGAAGTA
GTTGGAGTTTCGATGAAGACCACTGCAAACCCGTCTGGGATTTCCAGGGAGCAAGATTTGTACAACAAGTTTGCCGATGTCTGCAACTATATATTCCTCAATTATGAT
CCTTATCATGACCTCGAACTCCATAACGATGCTGCTAAGACAATTGCTGAAATTGCGGGGACCCTCAAGTCGCACCTCGAGAGATTGAAGGATGGCCTG
TTCTCTATCAGTGGCCTAGTG
GACACGACGAAGCACTTCTGGACCGGCGCTAACGACCACAGTGATGCCTTTTTGAAGTCATTGCTTTCGGCCAACAAGAACGCAAATTTGGACGATTTGGCCAAAGCTTTGGTGTTGGAG
GTTGTTGGGACGGCTGCTCTCTACTCCAAGGCCATCGCCCACGTCATCGATTTTTATCTGGACCAAGACGCAGCCTGCAAAGATATCCTCCAGCTCGCGACTGTGAATACCACAGCCTCG
GACGCAAAGCTTTCCAGCTACATTCGCGAGGCGCTTC
GTCTCAAGCCGGTGGTTTCAGGAGTCTATTCCGTAGCGCAACACGATGCCACGGTTGGCCCTCAAACTAAGGTCTCAAAGGGC
ACGAACGTCTATGCAAGTGTCATCAAGGCGGACCTTGAT
CCCAGTGTCTTTGGACCTGACCCCACAACCCCCAACTTCACGCGACCCGTCGCAGGTTTGCTAGGTTTGGAGGACTACGGC
CTTCTCACATCTTCTTTCTTCGAGAAG
ACTGCATCCGAAGTGCTCATCGCCGTCTTGACTTTGAAGTCCGTGGCAAGGGCGCCTGGCTACTCCGGAATCTTCAATACGTTTACACAAGAT
CAAAGCGGTTCGAAGGAAGTTTTGTATATCAACCCAGGTGGTGTGGTGACTCCTTGGCCCTCGTCACTGGTGTTGCAG
TACACCGCATGA

Retrieve as FASTA