Entry information : JargLDS04
Entry ID 10731
Creation 2012-03-08 (Christophe Dunand)
Last sequence changes 2012-03-08 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-11 (Catherine Mathe)
Peroxidase information: JargLDS04
Name JargLDS04
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS003]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Jaapiaceae Jaapia
Organism Jaapia argillacea    [TaxId: 202697 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value JargLDS04
start..stop
S start..stop
JargLDS03 785 0 69..984 24..958
JargLDS03 170 6e-43 1079..1342 999..1267
PindLDS01 305 9e-86 155..1014 329..1174
CcinLDS02 284 4e-80 130..729 101..735
PplLDS02 282 2e-79 124..985 73..892
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 419877..420065 189 N° 2 420117..420266 150 N° 3 420325..420356 32 N° 4 420434..420512 79
N° 5 420563..420625 63 N° 6 420688..420909 222 N° 7 420961..421164 204 N° 8 421257..421337 81
N° 9 421397..421480 84 N° 10 421543..421643 101 N° 11 421708..421730 23 N° 12 421760..421870 111
N° 13 421969..422060 92 N° 14 422115..422174 60 N° 15 422231..422254 24 N° 16 422308..422350 43
N° 17 422412..422492 81 N° 18 422541..422781 241 N° 19 422845..422874 30 N° 20 422931..422952 22
N° 21 423005..423105 101 N° 22 423161..423236 76 N° 23 423302..423378 77 N° 24 423410..423566 157
N° 25 423616..423946 331 N° 26 424002..424160 159 N° 27 424215..424618 404 N° 28 424835..424915 81
N° 29 424972..425040 69 N° 30 425162..425234 73 N° 31 425343..425822 480 N° 32 425902..425990 89
join(419877..420065,420117..420266,420325..420356,420434..420512,420563..420625, 420688..420909,420961..421164,421257..421337,421397..421480,421543..421643,42170 8..421730,421760..421870,421969..422060,422115..422174,422231..422254,422308..42 2350,422412..422492,422541..422781,422845..422874,422931..422952,423005..423105, 423161..423236,423302..423378,423410..423566,423616..423946,424002..424160,42421 5..424618,424835..424915,424972..425040,425162..425234,425343..425822,425902..42 5990)


exon

Literature and cross-references JargLDS04
DNA ref. JGI genome:   scaffold_31 (419877..425990)
Cluster/Prediction ref. JGI gene:   50265
Protein sequence: JargLDS04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1343 (1314)
PWM (Da):   %s   151059.93 (148016.5)  
PI (pH):   %s   5.19 (5.19) Peptide Signal:   %s   cut: 29 range:29-1342
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAALSATASLSLFSHISVMFLQVFDSMASKVPQAESLSSRTQFKWFGLEALNPPQVNPTEVAHLTILNLMKGREVDDRELMVQCFDLAFLRSSLIVPLKDQAAGSIEGHVRRTPPSLTAELPNTVEKLNPLQTPPDVGKVFDDLLSAKNGFNPHPNKISGMAFAFATVISLTLSRTCPSKWEYNDTAHCFDLSPLYGLNEKEEELVRDKNGQGMLSPDCFCEDRRIFLMPAVSVLLVLWNRNHNFIARRLLIDKDSKWIDPSTVNPSADRKLHPDLADQDDKIFKTAHMINCGIFRNVVLEDFLKGLLGLPNDVLSSDGQKAKSMQQYRSRTEFSLLYNWSALASEEDMKWTEKTIQEIFNGKSPDTPTLADFQHVSGCCGHETNLANKYTPNLQDHHLRRFDCGGDYIARLNTLNCWYTWVLKNGPLCVNNGDNGHEAGKGMESFTSFKEWNLSPDIITAATSLYGDIENLELPGLQAEDPVCGSGFNFGHTMIYGILVEIITLVWDDPNLPKFTAKEMTDWGYNECLAQLDNGASGAVLPKVLLANLPQNYPYNNIYTLFPFTLPSATKDVLGPDLADYNTKRPEKTVVLKSEKDISAVFNDPESFPTMYGPKLRELTNRYGFLLGFDNTRLHDAEQVISYALIPDRREMQRHAVYFAETVEGFIKETERSWISGSAINIVKDVINPTCSCWVCEAYGLPQHSRDRKNHEAEVFKKFGDLYTNSQSHYLTFSFLFHIHESDEGWAVRKKALDAVKELATHIRDQVDVIKDDAEGIIGRLNYAYNMLQSGECEVKPLSSTKFLKRLSLASGSLQRALGGFEKFQKFDDFKDFWGTKLQGAEQREPQDKRLSVQLDKNAEEEFKKLRLVSNVLILCIISSVGFARAWAHAVEFYLHKDCSKERNRIAELSQLDTAKGTDKGTDKSSDSEIMGYIREAQRLGQSPGLFRVVKKKPTTQQLEGLQVKEGDLIYADFRKAHIQKTCSEDRAVPPEDFPTQMDHPARVTENYTVPDEDAPTQTDRPVKVTEDYAVPGEDFPTQTDHPSKVVKDHAVPCEDVPTQMGDPTKVVEDPTVFKAIFRLNITLADEHESSASHNPILSPYSNMFVDSNGKFTSIPQTLLIREKYTTRQVDSPRQSFGKVTTVESDYVLTIWGRLSALLALPSVPKLTLPSIPRPWVPLALHAQELRPSTPIEENPANITVATLEVFDPYHVEEIRLGLDNKPIPVKRTYERGRPYQLTIIDVDKRDMRVSIFVDGILRGVTTDFDLDKLIDCELDSRACVALNFSTGVIVILLGNHTVEVRWAGKEYANGTDDADWGGEDIRRFQMQVEDYAGS

Retrieve as FASTA  
Remarks Complete sequence from genomic (31 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCTCTTTCAGCAACAGCTTCTCTGTCCTTATTCAGTCATATCAGTGTGATGTTCCTCCAGGTCTTCGATTCAATGGCATCGAAGGTACCTCAGGCCGAGTCCCTATCCAGTCGC
ACCCAGTTCAAGTGGTTTGGTTTGGAGGCATTGAATCCACCTCAGGTCAATCCCACAGAGGTGGCCCAT
GTGCGATTTTTGTGCACTCTGTTGGAACACAACTCACAAAGCCCATCTTAG

CTTACTATTTTGAACCTCATGAAAGGAAGGGAGGTTGACGACAGGGAGCTGATGGTACAATGTTTTGATTTAGCGTTCCTTCGCTCCTCTCTGATTGTGCCTCTGAAAGATCAAGCTGCG
GGAAGCATTGAAGGACATGTCAGGCGCACC
GTGTGACGCTTTGCGGAAATCGACATTCAATAAGATTTTGATTGAACTCCGTACATAGCCTCCTTCCTTGACTGCAGAACTCCCTAACAC
GTGCGCTGGTTAGTATATCACCCCAAGCTTCTCCCACTCCATCCTGCCAGCCCCTTGCATCACCTTTATGTGCGCAGTGTCGAGAAACTCAACCCACTGCAAACTCCTCCAGACGTAGGA
AAAGTATTTGATGATCTCCTCAGCGCCAAGAACGAG
GTACGTGTGGCCTTTCAATTCTAAGCCTTGAAATAGTTTACACTTCATAGGGATTCAACCCTCACCCAAACAAAATCTCAGGCA
TGGCTTTTGCTTTTGCAACAGTTATCTCA
GTGGGTCCCATCCTAGTACCTTTATCTTCGCAGCTTTCTGATGGTAAGAGGTTAATCTGCAGCTTACACTTTCCCGGACTTGCCCTTCTAA
ATGGGAGTACAATGATACTGCACACTGTTTTGATCTCTCACCCCTGTATGGGTTGAACGAGAAAGAGGAAGAGCTGGTCAGGGACAAGAATGGTCAGGGAATGCTGTCTCCAGATTGTTT
CTGCGAAGATCGCAGAATATTCTTGATGCCTGCAGTATCAGTGTTGTTGGTCCTTTGGAACAGGAATCATAAT
GTGCATTTGTATTGCAAGTCACTTATGGTCCTGACTTTTTGTGGTGG
ACAGTTTATTGCTCGTCGCCTCCTGATTGACAAAGATTCGAAATGGATAGACCCCTCCACAGTCAATCCCTCTGCTGATCGCAAACTTCACCCTGATTTAGCTGACCAAGATGACAAAAT
CTTCAAAACTGCTCACATGATCAACTGTGGCATCTTCAGAAATGTTGTCCTTGAAGATTTTCTGAAAGGACTTCTTGGACTGCCCAAT
GTGTGACCCAACGTGCATCTAAATCTCTTCGC
CAAGGTGAGTTCTCTATCTCTCTCAACTATCATTTCACATTGGGACACCATAGGAATTAGGATGTGTTATCAAGCGATGGTCAGAAGGCCAAAAGTATGCAACAATATCGATCGAGGACA
GAGTTTTCTCTTCTCTATAAT
GTGAGCCCCATCTGATTCCCCTTGCTTCCAACATGATTCATAATCAATTTCCTCCTTAGTGGTCTGCCCTAGCATCTGAGGAAGATATGAAGTGGACTG
AGAAGACTATACAAGAGATCTTCAACGGGAAGTCTCCAGACACA
GTTTGTGGATTCTGTTTCATCTGTTTTCATTATCCTCGACCCTCATGCAAAACTGCCCATAGCCTACACTAGCTGA
CTTTCAACATGTCTCTGGTTGTTGTGGGCATGAGACCAATTTGGCCAACAAATATACCCCAAATCTGCAAGATCACCATTTGAGACG
GTACACTTTCAAGATGATTTCCATTTTTCTTCA
CTGTGAGGCCTCACATAAAACTATCTATCAGCTTTGACTGTGGTGGTGATGATTGTCAGTTCAATGACAATGAAATTGCCAAGATATTGCAAGACTCAACACGCTCAACTGCTGGTACAC
CTGGGTCTTGAAAAATGGCCCCCTGTGTGTGAATAATGGAGACAATGGTCATGAAGCTGGCAAGGGAATGGAAT
GTATGTTCACTCAATGACTTCCAAAGGTCTTTGGGCCTCAAAGGTT
TGTCTTTTATCCTCTTACATTCTAGACTATTTTATCACCACAGGAACAACAGCCTTTACCTCCTTTAAGGAATGGAACTTGTCACCAGATATTATCACTGCAGCAACCAGTTTGTATGGT
GACATTGAGAATCTGGAGCTTTAT
GTATGTCTCTTCATGGGAATGTTTTTTGCAACCGCTGACTCTGACTGACCTCAGCCTGGTCTCCAAGCTGAAGATCCTGTCTGCGGAAGTGGTTTC
AACTTTGGACATACAATG
GTGAGGTCCTGTGGAATTCAACAGAGGACACCACTAATAAATCCTTTGGGCCAAAGATCTATGGTATCTTGGTAGAGATTGTATGTTGTTGACTCTTCCAAA
TGGTGCTTATATCACTCATGTATTCATCAAGATAACCTTGGTTTGGGATGATCCAAACCTTCCTAAGTTTACAGGTGGGTTGCATTCTCTGTTGAATTCAATCTCTGCTTAGTAGGTTTT
ACTAAACTGAATTAGCAAAGGAAATGACAGACTGGGGTTATAATGAATGCTTAGCCCAGCTGGACAATGGTGCATCTGGAGCTGTCTTACCCAAAGGTGACTGAGATGTTATTTATTTGA
TCTTGCACTCACACATATACTCAGTTTTGCTTGCCAACCTTCCCCAAAACTACCCATACAACAATATATATACCCTCTTCCCATTCACATTGCCAAGTGCCACCAAGGATGTTCTAGGCC
CTGACCTGGCAGACTACAACACCAAGCGACCTGAGAAAACTGTAGTCTTAAAGAGCGAGAAAGATATCAGTGCAGTCTTCAATGACCCGGAAAGCTTTCCGACAATGTATGGACCAAAAC
TCAGGGAATTGACCAACAGATATGG
GTGAGATGAAACTATCTATGTGCCTAGACACCCTTCTAACTCTCATTCACAAATCACTACTAGTTTCCTCCTTGGGTTTGACAATACCAGGCTGT
ATGTGGCTTCTGTCTTCCTGTCCCATCCCCCAGTGCTTATGTGCTCTCTTTTAGACATGATGCGGAACAGGTCACGGTGATACTACTCCTTGCTTCTCACATCTCGCGATTCATGAACAC
CCTCATAGATATCATATGCTCTGATCCCGGATAGGAGAGAGATGCAGAGACACGCAGTGTACTTTGCTGAAACAGTGGAGGGTTTTATCAAGGAAACTGAAAGGTCCTGGTATGCCTCCA
ATCCGTCACATTTTTGTCCTTCCATTTGTCCATCTCTGGATCAGGATCAGTGGCAGTGCTATCAATATTGTCAAAGATGTTATCAACCCGACTTGTAGCTGCTGGGTCTGTGAAGCAATG
GTAAGCTGAGAGGTTGTCCACACCCTTATTTCCATCCTTATTCTGGCTTTGATTCCCATCCATAGTATGGCCTTCCTCAGCACAGTCGTGATAGGAAGAACCATGAGGCTGAGGTATTCA
AAAAGTTTGGGGACCTGTATAC
GTTAGCATGTCTTTGCAATCCACACCTCCAGGAACTCACAATCACATTACCTCACGTTTAGTTTCCTTTTCCATATCCACGAGTCTGATGAGGGCTGG
GCTGTTCGCAAGAAGGCCTTGGACGCAGTGAAGGAACTCGCGACACATATCAGAGACCAGGTCGATGTGATCAAGGATGATGCTGAGGAG
GTGAGTGCTTTCCCTTCCACTTGTTTGTGT
CGTCCAAACATTATTCCAGGGGATCATAGGTCGGCTCAATTACGCCTACAACATGCTACAGTCAGGGGAATGCGAAGTGAAGCCTCTATCGTCAACCAAGTTTCTCAAGAGATTGTCTCT
GGCAAGCGGAAGTTTACAACGTGCCCTTGGTGGTTTCGAAAAATTCCAGAAATTTGACGATTTCAAAGACTTTTGGGGAACAAAGTTGCAGGGAGCGGAACAAAGGGAGCCGCAGGACAA
AAGGCTCAGTGTCCAACTGGACAAAAATGCGGAAGAGGAGTTCAAGAAGCTCAGATTAGTGTCCAATGTTCTCATACTGTGCATTATATCTTCTGTGGGCTTTGCTCGAG
GTAAGTAACC
CACTCTCGGTTGATTCCCTGCCTCACTTTTCATGAAATTATGCAGCCTGGGCCCATGCAGTCGAATTCTACTTGCACAAGGATTGCAGCAAGGAGAGAAATAGGATTGCAGAACTGTCAC
AGTTGGATACTGCGAAGGGTACTGACAAGGGTACTGACAAGTCTTCCGATAGTGAAATCATGGGCTATATCCGAGAAGCCCAAA
GTGAGCGCTTTATTTGAATGATGCTGATAACACTGG
TCTCATATATCTCAATAGGGCTGGGTCAGTCCCCAGGACTCTTTCGTGTGGTCAAAAAGAAGCCCACAACACAGCAATTGGAGGGGCTGCAGGTCAAGGAGGGGGATCTGATATATGCAG
ACTTTCGCAAGGCACACATTCAAAAGACTTGTTCTGAAGACCGTGCAGTGCCCCCTGAGGATTTTCCTACACAGATGGACCACCCCGCCAGAGTCACTGAAAACTATACGGTGCCCGATG
AAGATGCTCCTACGCAGACAGACCGCCCTGTCAAAGTCACTGAAGACTATGCAGTGCCTGGCGAGGATTTTCCTACGCAAACGGACCACCCTTCCAAAGTTGTTAAAGATCATGCAGTGC
CCTGTGAAGATGTTCCTACACAGATGGGCGACCCCACTAAAGTTGTTGAAGACCCTACCAAT
GTCAACTGGAAGTGAAAGATGGATTCAGTTCAAGGCCTCGGGTTTCACAAGTGTCCTG
GAATCAGTTTCGTTGAGGCGGTCAGTCTCCATCCAGCTGGTGTTTTCGATTTTGTGCACTCATAGCACCCTTATCTTGCTGCAGACTATGCCGCCGGTGCTCGTTTCCAGTCCTTCGAGC
TTCGGTTTGGCACTAATGCCCCCTCCCTTCTTTTCTAGGTTTTCAAGGCAATATTTCGCTTGAACATTACCCTTGCTGATGAACATGAATCAAGTGCTAGTCACAACCCGATCCTCAGTG
TGGGTTAACCGCCTAAAAGGTTTTGGCGCTACTCACTCAACTTCTGTCCCTACAGCCATATTCGAATATGTTTGTCGACTCGAATGGGAAATTCACATCAATCCCTCAAACACTTCTGAT
AAGG
GTCCGTGGTTTGGTCTCATCACCTCCTCCCAGCCCTTACCGACGTCTATCAAATTGTAGTATGATGCCCAACCGAGCCTACTTATTTTCTGCCGAACCTTCCTTGAAAACCTCCAT
TGCAGGAGAAATACACGACCCGACAAGTGGACAGTCCCAGACAAAGTTTTGGCAAGGTCACAACGGTGGAAAGCGATTGTAAGAGATCTCAAAGTGGGGACTGTAGTCATATTCCTCTTG
CTTACTCTATGTTTGTTCTCCTCATCTAAGTCGCCTTCCATCATGTCTGATTGCCATGTCCAACAGATGTCCTGACTATTTGGGGGAGATTGTCTGCCCTCCTGGCATTGCCCTCAGTGC
CAAAGCTCACCCTCCCTTCAATCCCTCGCCCATGGGTACCATTAGCATTACACGCGCAGGAGCTTCGTCCTTCGACGCCAATCGAAGAAAATCCTGCAAACATCACAGTTGCTACTTTGG
AGGTCTTCGATCCCTACCATGTAGAAGAGATACGTCTCGGTCTGGATAACAAACCCATTCCAGTCAAACGTACCTACGAGAGAGGGAGGCCATACCAGCTCACCATTATCGATGTCGATA
AACGCGACATGCGTGTGTCAATCTTTGTTGATGGGATACTGAGAGGAGTCACGACGGACTTCGACCTCGACAAGTTGATAGATTGTGAGTTGGACTCGCGGGCTTGTGTTGCTTTGAACT
TCAGCACTGGAGTCATTGTTATACTGTTGGGGAATCATACGGTTGAGGTTCGATGGGCGGGCAAAG
GTGAGCATAAAAATTTACTCAACGAACTAACCTCTCACTTATGGAAACCCTTCT
TATGGACAACCGGTCATCTCCACAGAATATGCTAATGGGACAGACGATGCTGATTGGGGAGGTGAAGATATCCGTCGATTTCAAATGCAAGTTGAGGATTACGCTGGATCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCTCTTTCAGCAACAGCTTCTCTGTCCTTATTCAGTCATATCAGTGTGATGTTCCTCCAGGTCTTCGATTCAATGGCATCGAAGGTACCTCAGGCCGAGTCCCTATCCAGTCGC
ACCCAGTTCAAGTGGTTTGGTTTGGAGGCATTGAATCCACCTCAGGTCAATCCCACAGAGGTGGCCCAT
CTTACTATTTTGAACCTCATGAAAGGAAGGGAGGTTGACGACAGGGAGCTG
ATGGTACAATGTTTTGATTTAGCGTTCCTTCGCTCCTCTCTGATTGTGCCTCTGAAAGATCAAGCTGCGGGAAGCATTGAAGGACATGTCAGGCGCACC
CCTCCTTCCTTGACTGCAGAA
CTCCCTAACAC
TGTCGAGAAACTCAACCCACTGCAAACTCCTCCAGACGTAGGAAAAGTATTTGATGATCTCCTCAGCGCCAAGAACGAGGGATTCAACCCTCACCCAAACAAAATCTCA
GGCATGGCTTTTGCTTTTGCAACAGTTATCTCA
CTTACACTTTCCCGGACTTGCCCTTCTAAATGGGAGTACAATGATACTGCACACTGTTTTGATCTCTCACCCCTGTATGGGTTGAAC
GAGAAAGAGGAAGAGCTGGTCAGGGACAAGAATGGTCAGGGAATGCTGTCTCCAGATTGTTTCTGCGAAGATCGCAGAATATTCTTGATGCCTGCAGTATCAGTGTTGTTGGTCCTTTGG
AACAGGAATCATAAT
TTTATTGCTCGTCGCCTCCTGATTGACAAAGATTCGAAATGGATAGACCCCTCCACAGTCAATCCCTCTGCTGATCGCAAACTTCACCCTGATTTAGCTGACCAA
GATGACAAAATCTTCAAAACTGCTCACATGATCAACTGTGGCATCTTCAGAAATGTTGTCCTTGAAGATTTTCTGAAAGGACTTCTTGGACTGCCCAAT
GATGTGTTATCAAGCGATGGT
CAGAAGGCCAAAAGTATGCAACAATATCGATCGAGGACAGAGTTTTCTCTTCTCTATAAT
TGGTCTGCCCTAGCATCTGAGGAAGATATGAAGTGGACTGAGAAGACTATACAAGAGATC
TTCAACGGGAAGTCTCCAGACACA
CCTACACTAGCTGACTTTCAACATGTCTCTGGTTGTTGTGGGCATGAGACCAATTTGGCCAACAAATATACCCCAAATCTGCAAGATCACCATTTG
AGACG
CTTTGACTGTGGTGGTGATGATTATATTGCAAGACTCAACACGCTCAACTGCTGGTACACCTGGGTCTTGAAAAATGGCCCCCTGTGTGTGAATAATGGAGACAATGGTCATGAA
GCTGGCAAGGGAATGGAAT
CCTTTACCTCCTTTAAGGAATGGAACTTGTCACCAGATATTATCACTGCAGCAACCAGTTTGTATGGTGACATTGAGAATCTGGAGCTTTATCCTGGTCTC
CAAGCTGAAGATCCTGTCTGCGGAAGTGGTTTCAACTTTGGACATACAATG
ATCTATGGTATCTTGGTAGAGATTATAACCTTGGTTTGGGATGATCCAAACCTTCCTAAGTTTACAGCA
AAGGAAATGACAGACTGGGGTTATAATGAATGCTTAGCCCAGCTGGACAATGGTGCATCTGGAGCTGTCTTACCCAAAG
TTTTGCTTGCCAACCTTCCCCAAAACTACCCATACAACAAT
ATATATACCCTCTTCCCATTCACATTGCCAAGTGCCACCAAGGATGTTCTAGGCCCTGACCTGGCAGACTACAACACCAAGCGACCTGAGAAAACTGTAGTCTTAAAGAGCGAGAAAGAT
ATCAGTGCAGTCTTCAATGACCCGGAAAGCTTTCCGACAATGTATGGACCAAAACTCAGGGAATTGACCAACAGATATGG
TTTCCTCCTTGGGTTTGACAATACCAGGCTACATGATGCG
GAACAGGTCACG
ATATCATATGCTCTGATCCCGGATAGGAGAGAGATGCAGAGACACGCAGTGTACTTTGCTGAAACAGTGGAGGGTTTTATCAAGGAAACTGAAAGGTCCTGGATCAGT
GGCAGTGCTATCAATATTGTCAAAGATGTTATCAACCCGACTTGTAGCTGCTGGGTCTGTGAAGCAATG
TATGGCCTTCCTCAGCACAGTCGTGATAGGAAGAACCATGAGGCTGAGGTA
TTCAAAAAGTTTGGGGACCTGTATAC
GAACTCACAATCACATTACCTCACGTTTAGTTTCCTTTTCCATATCCACGAGTCTGATGAGGGCTGGGCTGTTCGCAAGAAGGCCTTGGACGCA
GTGAAGGAACTCGCGACACATATCAGAGACCAGGTCGATGTGATCAAGGATGATGCTGAGGAG
GGGATCATAGGTCGGCTCAATTACGCCTACAACATGCTACAGTCAGGGGAATGCGAA
GTGAAGCCTCTATCGTCAACCAAGTTTCTCAAGAGATTGTCTCTGGCAAGCGGAAGTTTACAACGTGCCCTTGGTGGTTTCGAAAAATTCCAGAAATTTGACGATTTCAAAGACTTTTGG
GGAACAAAGTTGCAGGGAGCGGAACAAAGGGAGCCGCAGGACAAAAGGCTCAGTGTCCAACTGGACAAAAATGCGGAAGAGGAGTTCAAGAAGCTCAGATTAGTGTCCAATGTTCTCATA
CTGTGCATTATATCTTCTGTGGGCTTTGCTCGAG
CCTGGGCCCATGCAGTCGAATTCTACTTGCACAAGGATTGCAGCAAGGAGAGAAATAGGATTGCAGAACTGTCACAGTTGGATACT
GCGAAGGGTACTGACAAGGGTACTGACAAGTCTTCCGATAGTGAAATCATGGGCTATATCCGAGAAGCCCAAA
GGCTGGGTCAGTCCCCAGGACTCTTTCGTGTGGTCAAAAAGAAGCCC
ACAACACAGCAATTGGAGGGGCTGCAGGTCAAGGAGGGGGATCTGATATATGCAGACTTTCGCAAGGCACACATTCAAAAGACTTGTTCTGAAGACCGTGCAGTGCCCCCTGAGGATTTT
CCTACACAGATGGACCACCCCGCCAGAGTCACTGAAAACTATACGGTGCCCGATGAAGATGCTCCTACGCAGACAGACCGCCCTGTCAAAGTCACTGAAGACTATGCAGTGCCTGGCGAG
GATTTTCCTACGCAAACGGACCACCCTTCCAAAGTTGTTAAAGATCATGCAGTGCCCTGTGAAGATGTTCCTACACAGATGGGCGACCCCACTAAAGTTGTTGAAGACCCTACCAAT
GTT
TTCAAGGCAATATTTCGCTTGAACATTACCCTTGCTGATGAACATGAATCAAGTGCTAGTCACAACCCGATCCTCAGT
CCATATTCGAATATGTTTGTCGACTCGAATGGGAAATTCACA
TCAATCCCTCAAACACTTCTGATAAGG
GAGAAATACACGACCCGACAAGTGGACAGTCCCAGACAAAGTTTTGGCAAGGTCACAACGGTGGAAAGCGATTATGTCCTGACTATTTGGGGG
AGATTGTCTGCCCTCCTGGCATTGCCCTCAGTGCCAAAGCTCACCCTCCCTTCAATCCCTCGCCCATGGGTACCATTAGCATTACACGCGCAGGAGCTTCGTCCTTCGACGCCAATCGAA
GAAAATCCTGCAAACATCACAGTTGCTACTTTGGAGGTCTTCGATCCCTACCATGTAGAAGAGATACGTCTCGGTCTGGATAACAAACCCATTCCAGTCAAACGTACCTACGAGAGAGGG
AGGCCATACCAGCTCACCATTATCGATGTCGATAAACGCGACATGCGTGTGTCAATCTTTGTTGATGGGATACTGAGAGGAGTCACGACGGACTTCGACCTCGACAAGTTGATAGATTGT
GAGTTGGACTCGCGGGCTTGTGTTGCTTTGAACTTCAGCACTGGAGTCATTGTTATACTGTTGGGGAATCATACGGTTGAGGTTCGATGGGCGGGCAAAG
AATATGCTAATGGGACAGAC
GATGCTGATTGGGGAGGTGAAGATATCCGTCGATTTCAAATGCAAGTTGAGGATTACGCTGGATCTTGA

Retrieve as FASTA