Entry information : PindLDS01
Entry ID 10734
Creation 2012-03-09 (Christophe Dunand)
Last sequence changes 2012-03-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-09 (Christophe Dunand)
Peroxidase information: PindLDS01
Name PindLDS01
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Sebacinaceae Piriformospora
Organism Piriformospora indica    [TaxId: 65672 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PindLDS01
start..stop
S start..stop
JargLDS01 771 0 243..1250 138..1067
JargLDS01 59 0.000000006 58..151 42..134
LbiLDS01 728 0 243..1250 146..1070
LbiLDS01 55 0.0000001 85..135 68..118
AbLDS01_burnettii 706 0 212..1252 116..1084
AbLDS01_burnettii 50 0.000004 1..143 1..129
CcinLDS01 706 0 243..1252 134..1088
CcinLDS01 52 0.000001 23..135 6..116
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3249..3272 24 N° 2 3476..3634 159 N° 3 3688..4761 1074 N° 4 4813..5166 354
N° 5 5217..5407 191 N° 6 5466..5712 247 N° 7 5762..5948 187 N° 8 5997..6129 133
N° 9 6177..6438 262 N° 10 6485..6661 177 N° 11 6708..6793 86 N° 12 6843..6969 127
N° 13 7021..7195 175 N° 14 7246..7514 269 N° 15 7563..7645 83 N° 16 7694..7721 28
N° 17 7770..7849 80 N° 18 7898..7988 91 N° 19 8036..8047 12  
join(3249..3272,3476..3634,3688..4761,4813..5166,5217..5407,5466..5712,5762..594 8,5997..6129,6177..6438,6485..6661,6708..6793,6843..6969,7021..7195,7246..7514,7 563..7645,7694..7721,7770..7849,7898..7988,8036..8047)


exon

Literature and cross-references PindLDS01
Protein sequence: PindLDS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1252
PWM (Da):   %s   138458.28  
PI (pH):   %s   7.38
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSTFVNSLLSAGQLADVVNRSYRGLPISQDGLSDEQAAPATENKREQEAWLLHAAKGLDAQIRRGLPLSPSAIPSFIDAFLHAQTSTGIDDRKLLLENVLAFMSRLPPGPIQSKVQDAVIQLFWDALPHPPNSFLPSMQVEPENVTEINGVRIGPGGYANVSRRRIGRTQVPPNSKPGAGASTTLPVPAAPAPVQQLPTPAPSGFVNGPAKPANGSTAPVDPTQTISLSPENRIPTKAYSSQFRTPSGAQNNLILPLLGAAGSPYARSVVPQHPVPHTILPDPGLVFDLLMRRRDPPSAAVKPAPGKPSRDYDPRVEAQFRSQGHGQRHPSGLSTMLFAFGDLIIHSLFRTSSDDSNVNLTSSYLDLSVLYGVDEAEMQTVRRYDGTGRIWEDCWADPRLFGMPPAVLAVLIVFSRNHNYVALRLLEINEARQYTSPSISPPKSNHVGADQIFPTLSGDPDKLRAQDDDIFNRARLINCAFFMNVILGDYLSGILGTFREASEWCLNPLEEIRKGGKTACPRAEGNCVSVEFNLLYRWHATMSHKDVDWLEMLVKKALPGEARIQSAPPGQLELSEDDYKAVAGMFAKFQAGAVRDRVFGGLKRTPEGGFADSDLARILHEATDTVACAYGARGIPSVMKAIEVMGIKQGRKWGVCSLNEFRKFVGLKQYESFEEWNPTGDIKVARNLYQHIDNLELYVGLMCEESKNPGPGAGLCPGYTISRAILADAVCLTRGDRFLTTDLTPFNLTSWGFQDCARDTKNGSLGGMFSKLLFRTLPDHYPASSIYAHFPFFTPPEMKHWLTEMKLIQNYNVDRPSSDPVRPTQSINSAQGIDRVLKDMSTFNTVYGDSIRYLSNGYGFFLAFDEEPKHRDARRMHAALYRDGAMKKYAEFYQREATRLIRLRSFETGPKSRGVNIVRDVINIVPVHWVSEELAGLPLKSEEAPRGLFTEQEMYGMFACVFTFIFLNIEPSNDWPLRQNSLKFSEIITGFVKARLQKIAGEGSFSLQGLKDTVLQFFTDKVDNSDEFYRTILNGNNGKYTIDQLASNVFAMIVASVANFAQATTHVVDFYLDKEREEEFKHLKDLSMDKTAEADALLAGYAREGLRFRPQAPGIFRRATKDVTVVEGNGLKPVDIKAGDRIFVSLTHAGMPSVFPDPTKVDPRRPREAYYAFGRGEHTCLGAMFTEMIPAVLRAVFSLPNVRRGPGYSGTLNTFKHDLFGTESHLYISNKGTVSPWPAFMMIYDV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (18 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTACATTTGTAAACTCCCTCGTACGTTCTTCTGTCCCCATTCTCAAAACCTGCGCGCTAACTGACTTGCTGCTCGTTGACCGCCGCCTCGTGTATGCTCGCCCTGTACTCGACGCG
GCTATTCGTTTCTTTGGATTCTCGTCTTTCTACTGGTTACTTGATACCCGACCCCGGAACTTGACAACTTCCGCTCAATTGTCTAAATGCACGCCACTATCCCATAGTTGTCCGCTGGAC
AGCTGGCAGATGTCGTAAACCGCTCTTATCGTGGTCTCCCAATCAGTCAAGACGGTCTCTCAGACGAACAGGCTGCTCCCGCGACGGAAAACAAGCGCGAACAAGAGGCCTGGTTGTTGC
ACGCCGCCAAAGGACTCGATGCTCAG
GTACATATATGCATTCTCCTCTCAATTTTCTTCGTATTCACACGGCCCTGCAGATCAGACGAGGACTTCCGCTCTCGCCAAGCGCAATTCCGTC
GTTTATTGATGCCTTTTTGCATGCTCAGACATCGACCGGAATCGATGACCGCAAACTGCTTTTGGAAAACGTTCTCGCGTTCATGTCCCGTCTTCCTCCTGGCCCAATCCAGAGCAAGGT
CCAAGACGCAGTCATTCAACTCTTTTGGGACGCGCTCCCACACCCGCCGAACAGCTTTCTCCCAAGTATGCAGGTCGAACCAGAGAATGTCACCGAGATCAACGGCGTTCGCATTGGCCC
TGGAGGGTATGCCAACGTAAGCCGAAGAAGGATTGGCCGCACTCAAGTTCCTCCAAATTCCAAACCTGGAGCCGGCGCATCCACCACCCTTCCCGTCCCAGCTGCTCCCGCTCCGGTGCA
GCAACTTCCCACGCCGGCTCCTTCTGGCTTTGTCAATGGACCCGCAAAGCCTGCAAACGGTTCGACTGCTCCAGTCGACCCAACTCAGACCATCTCTCTTTCACCAGAAAATCGTATCCC
GACAAAGGCCTATTCAAGCCAGTTCCGTACGCCCTCTGGAGCGCAGAATAATCTCATCCTACCCCTCCTTGGTGCTGCAGGAAGTCCCTATGCACGCTCCGTCGTCCCTCAGCATCCAGT
TCCTCATACGATTCTCCCCGACCCAGGTCTCGTCTTTGACTTGCTCATGCGTCGAAGGGATCCTCCCTCGGCTGCCGTCAAGCCCGCTCCAGGAAAGCCCTCCAGGGATTATGACCCGCG
CGTCGAAGCGCAATTCCGCTCTCAGGGACACGGCCAGCGCCATCCAAGCGGGTTGAGCACCATGTTGTTCGCGTTTGGTGATTTGATCATCCACTCGTTGTTCCGCACTAGCAGCGACGA
CTCGAATGTCAACCTCACCAGCAGCTATCTCGATCTTAGCGTGCTCTATGGTGTTGACGAGGCGGAGATGCAGACCGTGAGGCGATATGATGGTACCGGTCGTATCTGGGAGGACTGCTG
GGCAGACCCACGTCTTTTTGGTATGCCTCCTGCCGTCTTGGCCGTCTTGATCGTCTTTTCAAGGAACCACAAC
GTGAGTGACCGCCCCCAACCTTTTCCTGAACACTTGCTGATTTTTGA
CTAGTACGTTGCATTGAGACTGCTCGAGATCAACGAGGCACGTCAGTATACTTCACCGAGCATATCACCACCAAAGTCGAATCACGTTGGTGCCGACCAAATCTTCCCCACGCTCTCGGG
TGATCCAGACAAACTGCGCGCGCAAGACGATGACATTTTCAACCGTGCAAGATTGATCAACTGTGCATTCTTCATGAACGTTATTCTTGGCGATTATCTCTCTGGTATCCTCGGTACCTT
CCGCGAGGCGAGCGAATGGTGCCTCAACCCACTCGAGGAGATTCGCAAGGGTGGGAAGACGGCTTGTCCTCGTGCAGAGGGCAACTGCGTCAGCGTCGAGTTTAACCTTCTCTATCGC
GT
GCGTTGCTTTGATTCCTTTGACGATGACATTTTGACAATCTTCCCTAGTGGCATGCTACCATGTCCCACAAGGACGTCGATTGGCTTGAGATGCTAGTCAAAAAGGCACTTCCTGGCGAG
GCTCGTATCCAATCTGCACCCCCCGGTCAACTTGAATTGTCAGAGGATGATTACAAGGCCGTTGCAGGCATGTTTGCCAAATTCCAAGCGGGAGCTGTTCGCGATCGCGTATTCGGAGG
G
TCAGTTCTACTCATGCTCCCGAGTTGAAAATGCAAATTAATCGTTTTTTTTTTGTAGATTGAAGCGTACGCCCGAAGGTGGCTTCGCGGACTCTGACCTCGCGCGTATCCTCCACGAAGC
GACGGATACGGTTGCTTGTGCGTATGGTGCCAGGGGTATCCCATCCGTCATGAAGGCTATCGAGGTCATGGGTATCAAGCAAGGTCGCAAGTGGGGTGTCTGCTCTCTCAACGAGTTCCG
CAAATTTGTGGGACTCAAGCAATACGAGAGCTTTGAAGAGTGGAACCCGACGGGCGATATCGCT
GTACGTCCACTCTTTTGTGCTGTAGGATGTTTATTGACGCCTCCTATAGAAAGTCG
CTAGGAATCTTTATCAGCACATTGACAACCTGGAACTCTATGTCGGTTTGATGTGCGAGGAATCAAAGAATCCTGGTCCAGGTGCTGGTCTTTGCCCTGGGTACACCATTTCCCGTGCCA
TCCTAGCAGATGCAGTTTGCTTGACGCGAGGAGATCGATTCTTGACCACTGATCTTACGC
GTAAGTTGCCTTTTGGGACGGTTTTTGTTGACGCTGACTGCTCTATAGCGTTCAATTTGA
CATCATGGGGCTTCCAGGATTGCGCTCGAGATACGAAGAATGGATCCCTTGGAGGCATGTTCAGCAAGCTTCTCTTCCGTACTCTCCCGGATCACTATCCGGCTAGCTCCATCTACGCAC
A
GTACGTTCGTCCAGGGCTCGACTTTGCGCATGCTCACTTATTTCTAGCTTCCCCTTCTTCACACCACCGGAGATGAAACACTGGCTTACAGAGATGAAGTTGATCCAGAACTATAACGT
CGACAGGCCCTCTAGCGATCCCGTTCGCCCCACGCAGTCGATCAACTCTGCCCAGGGCATCGACCGTGTGCTCAAGGACATGTCAACGTTCAACACAGTCTACGGGGACAGTATTCGCTA
CCTTAGCAACGGCTACGGATTCTTCCTTGCGTTTGACGAGGAGCCCAAGCATCGTGATGCTCGTCGTTTG
GTATGCGTCGTTACATTGGCAATATTTTGTGCTGACTATCGCATAGATGC
ACGCTGCGCTTTATCGCGATGGTGCGATGAAGAAATATGCCGAGTTTTACCAGAGAGAGGCGACTCGTCTCATCAGGTTGAGGTCGTTTGAGACTGGGCCCAAGTCGAGAGGCGTGAATA
TTGTTCGTGATGTGATCAATATCGTCCCTGTGCACTGGGTGTCCGAGGAACTC
GTGAGTGAGCTCATTACGTAGATTGGCATCCGCTCACGCATTCTAGGCCGGACTTCCTCTCAAGTCG
GAGGAAGCTCCACGGGGTCTGTTCACGGAGCAAGAGATGTATGGCATGTTTGCCTGCGTTTTCAC
GTATGTGTCTGGGGGGGCTTTGATGGCTGGTCTCTGACGCACTGTCCAGGTTCAT
TTTCTTGAACATTGAGCCGTCCAACGATTGGCCACTTCGCCAGAATTCCCTCAAGTTTTCCGAGATTATCACTGGATTCGTCAAAGCGCGTCTGCAAAAGATTGCTGGAGAGGGCTCTTT
G
GTTTGTAAATTCCTTGGGTTTGGGCACCAAACTGAGATTGGTCGTGGACAGTTCTCTTTGCAGGGATTAAAGGACACGGTTCTCCAGTTCTTCACGGACAAAGTCGACAATAGTGACGA
GTTTTATCGCACAATCCTCAACGGAAACAACGGCAAGTATACCATTGATCAGTTGGCTTCCAATGTCTTTGCCATGATCGTCGCCAGCGTTGCCAACTTTGCTCAGG
GTGAGTGCGATTG
TCATTCTTTAATACCGCTTCTCATTCTTTATTGCCAGCGACCACCCACGTTGTGGACTTCTACTTGGACAAGGAGAGGGAGGAAGAGTTCAAGCATCTCAAGGATCTCTCCATGGACAAG
ACTGCCGAGGCGGATGCTCTTCTCGCTGGTTATGCTCGCGAGGGACTTCGCTTCCGGCCACAGGCACCTGGTATCTTTAGACGTGCAACCAAGGACGTGACAGTGGTAGAAGGAAACGGC
CTCAAGCCGGTTGATATCAAGGCTGGAGACCGCATCTTTGTCAGCCTTACGCATGCGGGCATGGAT
GTGAGTGTCTCTCTCCTTTAGAGATGTGTTTGCTAATGCTGTTCTCAGCCAAGC
GTCTTCCCTGATCCGACCAAGGTTGATCCTAGACGCCCGAGGGAAGCATACTACGCGTTTGGTCGTGGGGAGCATAC
GTAAGTGATGAGTGGACCAAGTTAACATGGCGACTGACTCTTG
GATAGTTGCCTCGGCGCCATGTTCACCGAAACGGTATGTCGAATGTACGTTGATTGCGACTTGAGTCTTACGTCTCTGTAGATGATCCCCGCAGTGCTTCGTGCCGTCTTTAGTCTCCCC
AACGTTCGCCGAGGACCGGGATATTCTGGAACGCTGAATAC
GTGAGTAGCGCTAGCTTGAGCGGGCCATGTCACTAACGACCTTGTTAGGTTCAAACACGACCTGTTTGGAACGGAGAGC
CATCTGTACATCTCGAACAAGGGCACTGTAAGTCCTTGGCCGGCGTTTATGATGATCGAG
GTATGTCGTTTCCTCCCCAGTCTACACATTGATCTCACATTTCCTAGTACGACGTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTACATTTGTAAACTCCCTCTTGTCCGCTGGACAGCTGGCAGATGTCGTAAACCGCTCTTATCGTGGTCTCCCAATCAGTCAAGACGGTCTCTCAGACGAACAGGCTGCTCCCGCG
ACGGAAAACAAGCGCGAACAAGAGGCCTGGTTGTTGCACGCCGCCAAAGGACTCGATGCTCAG
ATCAGACGAGGACTTCCGCTCTCGCCAAGCGCAATTCCGTCGTTTATTGATGCCTTT
TTGCATGCTCAGACATCGACCGGAATCGATGACCGCAAACTGCTTTTGGAAAACGTTCTCGCGTTCATGTCCCGTCTTCCTCCTGGCCCAATCCAGAGCAAGGTCCAAGACGCAGTCATT
CAACTCTTTTGGGACGCGCTCCCACACCCGCCGAACAGCTTTCTCCCAAGTATGCAGGTCGAACCAGAGAATGTCACCGAGATCAACGGCGTTCGCATTGGCCCTGGAGGGTATGCCAAC
GTAAGCCGAAGAAGGATTGGCCGCACTCAAGTTCCTCCAAATTCCAAACCTGGAGCCGGCGCATCCACCACCCTTCCCGTCCCAGCTGCTCCCGCTCCGGTGCAGCAACTTCCCACGCCG
GCTCCTTCTGGCTTTGTCAATGGACCCGCAAAGCCTGCAAACGGTTCGACTGCTCCAGTCGACCCAACTCAGACCATCTCTCTTTCACCAGAAAATCGTATCCCGACAAAGGCCTATTCA
AGCCAGTTCCGTACGCCCTCTGGAGCGCAGAATAATCTCATCCTACCCCTCCTTGGTGCTGCAGGAAGTCCCTATGCACGCTCCGTCGTCCCTCAGCATCCAGTTCCTCATACGATTCTC
CCCGACCCAGGTCTCGTCTTTGACTTGCTCATGCGTCGAAGGGATCCTCCCTCGGCTGCCGTCAAGCCCGCTCCAGGAAAGCCCTCCAGGGATTATGACCCGCGCGTCGAAGCGCAATTC
CGCTCTCAGGGACACGGCCAGCGCCATCCAAGCGGGTTGAGCACCATGTTGTTCGCGTTTGGTGATTTGATCATCCACTCGTTGTTCCGCACTAGCAGCGACGACTCGAATGTCAACCTC
ACCAGCAGCTATCTCGATCTTAGCGTGCTCTATGGTGTTGACGAGGCGGAGATGCAGACCGTGAGGCGATATGATGGTACCGGTCGTATCTGGGAGGACTGCTGGGCAGACCCACGTCTT
TTTGGTATGCCTCCTGCCGTCTTGGCCGTCTTGATCGTCTTTTCAAGGAACCACAAC
TACGTTGCATTGAGACTGCTCGAGATCAACGAGGCACGTCAGTATACTTCACCGAGCATATCA
CCACCAAAGTCGAATCACGTTGGTGCCGACCAAATCTTCCCCACGCTCTCGGGTGATCCAGACAAACTGCGCGCGCAAGACGATGACATTTTCAACCGTGCAAGATTGATCAACTGTGCA
TTCTTCATGAACGTTATTCTTGGCGATTATCTCTCTGGTATCCTCGGTACCTTCCGCGAGGCGAGCGAATGGTGCCTCAACCCACTCGAGGAGATTCGCAAGGGTGGGAAGACGGCTTGT
CCTCGTGCAGAGGGCAACTGCGTCAGCGTCGAGTTTAACCTTCTCTATCGC
TGGCATGCTACCATGTCCCACAAGGACGTCGATTGGCTTGAGATGCTAGTCAAAAAGGCACTTCCTGGC
GAGGCTCGTATCCAATCTGCACCCCCCGGTCAACTTGAATTGTCAGAGGATGATTACAAGGCCGTTGCAGGCATGTTTGCCAAATTCCAAGCGGGAGCTGTTCGCGATCGCGTATTCGGA
GG
ATTGAAGCGTACGCCCGAAGGTGGCTTCGCGGACTCTGACCTCGCGCGTATCCTCCACGAAGCGACGGATACGGTTGCTTGTGCGTATGGTGCCAGGGGTATCCCATCCGTCATGAAG
GCTATCGAGGTCATGGGTATCAAGCAAGGTCGCAAGTGGGGTGTCTGCTCTCTCAACGAGTTCCGCAAATTTGTGGGACTCAAGCAATACGAGAGCTTTGAAGAGTGGAACCCGACGGGC
GATATCGCT
AAAGTCGCTAGGAATCTTTATCAGCACATTGACAACCTGGAACTCTATGTCGGTTTGATGTGCGAGGAATCAAAGAATCCTGGTCCAGGTGCTGGTCTTTGCCCTGGGTAC
ACCATTTCCCGTGCCATCCTAGCAGATGCAGTTTGCTTGACGCGAGGAGATCGATTCTTGACCACTGATCTTACGC
CGTTCAATTTGACATCATGGGGCTTCCAGGATTGCGCTCGAGAT
ACGAAGAATGGATCCCTTGGAGGCATGTTCAGCAAGCTTCTCTTCCGTACTCTCCCGGATCACTATCCGGCTAGCTCCATCTACGCACA
CTTCCCCTTCTTCACACCACCGGAGATGAAA
CACTGGCTTACAGAGATGAAGTTGATCCAGAACTATAACGTCGACAGGCCCTCTAGCGATCCCGTTCGCCCCACGCAGTCGATCAACTCTGCCCAGGGCATCGACCGTGTGCTCAAGGAC
ATGTCAACGTTCAACACAGTCTACGGGGACAGTATTCGCTACCTTAGCAACGGCTACGGATTCTTCCTTGCGTTTGACGAGGAGCCCAAGCATCGTGATGCTCGTCGTTTG
ATGCACGCT
GCGCTTTATCGCGATGGTGCGATGAAGAAATATGCCGAGTTTTACCAGAGAGAGGCGACTCGTCTCATCAGGTTGAGGTCGTTTGAGACTGGGCCCAAGTCGAGAGGCGTGAATATTGTT
CGTGATGTGATCAATATCGTCCCTGTGCACTGGGTGTCCGAGGAACTC
GCCGGACTTCCTCTCAAGTCGGAGGAAGCTCCACGGGGTCTGTTCACGGAGCAAGAGATGTATGGCATGTTT
GCCTGCGTTTTCAC
GTTCATTTTCTTGAACATTGAGCCGTCCAACGATTGGCCACTTCGCCAGAATTCCCTCAAGTTTTCCGAGATTATCACTGGATTCGTCAAAGCGCGTCTGCAAAAG
ATTGCTGGAGAGGGCTCTTTG
TTCTCTTTGCAGGGATTAAAGGACACGGTTCTCCAGTTCTTCACGGACAAAGTCGACAATAGTGACGAGTTTTATCGCACAATCCTCAACGGAAACAAC
GGCAAGTATACCATTGATCAGTTGGCTTCCAATGTCTTTGCCATGATCGTCGCCAGCGTTGCCAACTTTGCTCAGG
CGACCACCCACGTTGTGGACTTCTACTTGGACAAGGAGAGGGAG
GAAGAGTTCAAGCATCTCAAGGATCTCTCCATGGACAAGACTGCCGAGGCGGATGCTCTTCTCGCTGGTTATGCTCGCGAGGGACTTCGCTTCCGGCCACAGGCACCTGGTATCTTTAGA
CGTGCAACCAAGGACGTGACAGTGGTAGAAGGAAACGGCCTCAAGCCGGTTGATATCAAGGCTGGAGACCGCATCTTTGTCAGCCTTACGCATGCGGGCATGGAT
CCAAGCGTCTTCCCT
GATCCGACCAAGGTTGATCCTAGACGCCCGAGGGAAGCATACTACGCGTTTGGTCGTGGGGAGCATAC
TTGCCTCGGCGCCATGTTCACCGAAACGATGATCCCCGCAGTGCTTCGTGCC
GTCTTTAGTCTCCCCAACGTTCGCCGAGGACCGGGATATTCTGGAACGCTGAATAC
GTTCAAACACGACCTGTTTGGAACGGAGAGCCATCTGTACATCTCGAACAAGGGCACTGTAAGT
CCTTGGCCGGCGTTTATGATGATCGAG
TACGACGTCTAA

Retrieve as FASTA