Entry information : PindLDS02
Entry ID 10735
Creation 2012-03-09 (Christophe Dunand)
Last sequence changes 2012-03-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-09 (Christophe Dunand)
Peroxidase information: PindLDS02
Name PindLDS02
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Sebacinaceae Piriformospora
Organism Piriformospora indica    [TaxId: 65672 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PindLDS02
start..stop
S start..stop
JargLDS02 872 0 61..1098 4..1041
SbreLDS02 859 0 89..1098 60..1068
SlutLDS02 852 0 89..1098 60..1067
PplLDS02 848 0 108..1096 1..994
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 25231..25302 72 N° 2 25023..25169 147 N° 3 24872..24979 108 N° 4 24075..24826 752
N° 5 23954..24031 78 N° 6 23753..23906 154 N° 7 23442..23703 262 N° 8 23351..23394 44
N° 9 23169..23304 136 N° 10 22725..23118 394 N° 11 22443..22674 232 N° 12 22194..22391 198
N° 13 22115..22141 27 N° 14 21919..22063 145 N° 15 21710..21871 162 N° 16 21566..21660 95
N° 17 21235..21516 282 N° 18 21172..21186 15  
complement(join(21172..21186,21235..21516,21566..21660,21710..21871,21919..22063 ,22115..22141,22194..22391,22443..22674,22725..23118,23169..23304,23351..23394,2 3442..23703,23753..23906,23954..24031,24075..24826,24872..24979,25023..25169,252 31..25302))


exon

Literature and cross-references PindLDS02
DNA ref. GenBank:   CAFZ01000028.1 (25302..21172)
Protein sequence: PindLDS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1100
PWM (Da):   %s   123110.41  
PI (pH):   %s   6.72
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSVTPPSPTPTVTSRVGEVLYATLNDSFDTAIHAVDEIYTANATMPGARDVDEDYDNGPQSPIAKSLYGAKNELNRWRGKSPPLPSFEIVSGLVDAGLNKGSIDDRKLLLEAALSTMSSLPKGALSDTLNRKTVALLYRDLPHPPPTFINNQYAWRQPDGSHNNPANPDLGKAGMPYARNVQSHTPMPMSEQPDPGLIFDSLLRRDRFRPHPAGNSALLFGFATLVIHTCFRTNHGDWTINDTSSYVDLSPLYGNSLEGQLKLRRQDGTGKMWNDVFAEDRLLFLPPISCALLVLFCRNHNYIAQKLLEINEKGRWKCPPPDDEQARMTQDDEIFNIARLINCGHFAGIVFSDYLAGILGLSHDANPWSLDPFSEIRNEDHTIVERGCGNANSVEFNLLYRWHATLSEPDVAWVERIFASSFAGKSAEEITIRDFNQVTENLREASRRDIKTWTFAGLHRGEDGKFHDSDIAKILMDATSHPAGAFGARHTPGIMRTIEIMTIQMARKWGVCTLNEFRKSLGLPYTTFQEWNPDPAIWMPAQALYEQVDRLELYVGLQAEDTKKPGPGAGLCPGYTISRAILDAIALTRGDRFYTYDFTPSTYTSWGYKDCQRDPTNPGAGSVLGPLFLRTLPNNYRPDSVFTWFPMLTPEATRKNLTRLGKADKYTFERPGELSMIKSVEDVGAVMDYTTGRGSRVVRSVYGPKAREIMDGGGYFVLLDDVRADMHRRAIQQAIFHNVEHTGPIARAIESKMRALIHHKSFELVKGKTKCIDIVKDVVNLAPIHWIADAGLPLKTHDHMKGTIFEQQADQIFKDIYSYIFHEIDPSLLVNFRGIVKKHVSFMMRYIEPQVQDSNGIIPSVAAIKDAIVGIWVDRRGDCGRFYDSMVANGFSRTDVMNDVLALAVLATVELSHLLVHVINFYLEEENKEYRDRITAAAFGDETVTAAELEGYVREAIRLDPVTVGVMREITTGTLSQASGQPLQANERIFVSLKKAMVEDLYPHPKSVDLHRSKEQKLLLGDGTSKLLGEDYILDVGAHVLKAVFSLKNLRRAPGPSGTLRRYVQDHNGTKQYFYLDQKQKISPWPTSMLLQYDQV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (17 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGGTGACCCCGCCTTCACCAACCCCGACCGTGACCTCGCGCGTCGGAGAGGTCCTCTACGCGACTCTGGTTAGTAATATCCACATTTGCGTTTCCAGACTGCATTCTGAACTCTTC
CTTTGTTATGTAGAACGACTCGTTTGACACTGCCATTCATGCTGTCGACGAGATTTATACCGCAAACGCTACCATGCCCGGCGCCAGAGACGTGGATGAAGATTACGACAATGGTCCCCA
AAGTCCTATTGCAAAGAGCTTGTATGGCGCCAAAAACGAA
GTACGCTCCATGTTTTCCCCCTGGTCTGCTCTGACGTTCGCAGCTCAACAGGTGGCGGGGCAAAAGTCCCCCTCTCCCAA
GCTTCGAAATCGTCAGTGGACTCGTCGACGCAGGCCTCAACAAGGGTAGCATAGATGACCGGAAACTCTTG
GTGTGTGCTCTTGCCCTGCTCAGGCCACCTTCTGACCCTCCCTAGCTCG
AAGCTGCCCTGTCAACAATGTCTTCGCTCCCCAAAGGTGCTCTCTCAGATACGCTTAACAGAAAGACGGTCGCCCTTCTCTATCGTGATTTACCTCACCCGCCGCCGACGTTTATAAACA
ACCAATACGCATGGCGACAACCCGATGGTTCGCACAACAATCCGGCGAACCCCGACCTCGGCAAGGCAGGGATGCCCTATGCACGCAACGTGCAGTCCCATACCCCAATGCCCATGAGCG
AGCAGCCCGATCCTGGCCTCATCTTCGATTCGCTCCTCAGGAGGGACCGTTTCAGGCCCCATCCAGCCGGCAACTCTGCCCTTCTTTTCGGTTTCGCGACGCTTGTCATTCATACTTGCT
TCCGCACCAATCACGGTGACTGGACGATCAACGATACCTCGTCCTACGTCGATCTCTCGCCACTCTACGGCAACTCCCTCGAGGGTCAGTTGAAGCTTCGTAGACAAGATGGTACCGGAA
AGATGTGGAACGACGTCTTCGCCGAGGATAGGCTCCTTTTCCTCCCGCCTATCAGCTGTGCACTTCTCGTTCTCTTCTGCAGAAACCACAACTATATCGCCCAGAAGCTCCTCGAGATCA
ATGAGAAGGGTCGTTGGAAGTGCCCGCCACCCGACGATGAGCAGGCTCGCATGACCCAAGACGACGAAATCTTCAATATTGCCCGTCTCATCAATTGTGGACACTTTGCTGGCATTGTCT
TCAGCGACTATCTTGCAGGCATTCTCGG
GTATGTGTACCTTGTCCTTGTGGATGTTGCTCATTCATATTAGGCTATCCCACGATGCTAATCCCTGGTCCCTGGATCCCTTCTCCGAGATT
CGTAATGAGGACCACACCATTGTCGAGCG
GTAGGCCCTTCATTGATTACGTAGATCTGTTACTGATTATTGACCAGTGGTTGCGGTAACGCGAACAGCGTCGAGTTCAACCTTCTCTATC
GCTGGCACGCCACCCTTTCCGAGCCAGACGTCGCTTGGGTTGAGCGCATATTCGCGTCGAGCTTTGCTGGAAAGTCTGCCGAGGAAATCACCATCCGTGATTTCAACCAG
GTAGGTTGGA
ATCTGACGCGCTTTATAGTTGGCTGAAAGTTGGTGATAGGTCACAGAAAATCTTAGAGAGGCCTCTAGGAGAGACATCAAGACGTGGACGTTTGCTGGTCTGCACCGCGGGGAAGATGGG
AAATTCCACGACTCTGATATTGCCAAAATCCTCATGGATGCCACCTCCCACCCAGCAGGCGCGTTTGGTGCTCGCCATACACCAGGTATCATGCGCACGATTGAGATCATGACTATCCAA
ATGGCTCGAAAGTGGGGTGTATGCACGCTCAACGAGTTCAGGAAGAGTCTTGGCTTGAAGC
GTGGGTGCTAAGTTTTTCTCATTGACGGTTCCGTTGACACCCCTAAGCGTACACTACGT
TCCAGGAGTGGAATCCAGATCCAGCCATCTGG
GTGAGTGCAAATTCACTCTTACGAACCGAGGTTGAACATGTTTTAGATGCCCGCTCAGGCTCTCTATGAGCAAGTGGACAGGCTCGAG
CTCTATGTCGGTCTTCAGGCAGAGGATACTAAGAAGCCTGGGCCTGGTGCCGGTTTGTGCCCAGGATACACAATCTCTAGGGCTATTCTCGCGG
GTACGAAAGTCCCTTTGATTATTCTG
ACGATTCTTTGACGGTCATAACAGATGCCATCGCGTTGACTCGTGGAGATCGATTCTACACTTACGATTTCACCCCATCGACCTATACTTCTTGGGGTTACAAGGATTGCCAGCGCGATC
CCACGAACCCTGGTGCTGGATCTGTTCTTGGTCCGCTCTTCCTTCGCACGCTGCCGAACAACTACCGCCCAGACTCCGTCTTCACGTGGTTCCCGATGCTTACCCCCGAAGCTACGCGAA
AGAACCTCACCCGCCTTGGCAAGGCGGACAAGTATACTTTTGAGCGACCCGGAGAATTGAGCATGATCAAATCCGTCGAAGACGTCGGCGCAGTTATGGACTACACTACCGGTCGCGGAT
CAAGGGTTGTCAGGAGCGTGTATGGACCCAAGGCGCGCGAGATCATGGATGGTGGCGG
GTAAGGCTACGTCCCAGTTGTGGGAAGAATGAGGCCAACGCTTTCTCTAGGTACTTTGTACT
TTTGGATGACGTCCGAGCAGACATGCACCGTCGCGCAATTCAGCAAGCCATTTTCCACAATGTCGAGCACACTGGTCCGATCGCCCGCGCAATCGAGTCCAAGATGCGTGCTCTTATTCA
CCACAAGAGTTTCGAGCTCGTCAAGGGCAAGACAAAATGCATCGACATTGTCAAGGACGTTGTCAACCTGGCACCCATTCATTGGATCGCCGACGCCCTC
GTGAGCTCCTAGCTGACTCC
AGAGCTGAATATGCAACTCATATCGTCGCAGGGTCTTCCTCTCAAGACACATGATCACATGAAGGGAACCATCTTCGAGCAGCAAGCTGATCAAATCTTCAAGGATATTTACTCGTACAT
CTTCCACGAGATTGACCCCTCGCTCTTGGTCAACTTCCGTGGGATTGTCAAGAAGCATGTCAGCTTTATGATGCGCTACATCGAGCCTCAAGTACAGGATTCGAATGGC
GTACGTGGAGC
TTAATGTGTGCTATGCTTCCTTTGTTGACATAAGGCTATAGATCATCCCCAGCGTTGCGGCAATCAAGGTATGGCATGCGAAGTCTTTGGAACATGTAAGATTGAACACCCCTTCGTAGG
ACGCTATCGTTGGCATCTGGGTCGACCGTCGTGGAGACTGCGGTCGCTTCTACGATTCCATGGTAGCCAATGGCTTCTCTAGGACCGACGTCATGAACGATGTGCTTGCGCTTGCCGTTC
TGGCCACAGTCGAACTTTCTCACT
GTGAGTCTTTCATTTACAAATATATACAGGTTCATGACGGGGTATAGTGCTCGTTCATGTGATCAACTTCTATCTCGAAGAGGAGAACAAGGAATA
TCGTGATCGCATCACTGCCGCCGCCTTTGGCGACGAGACTGTCACAGCTGCAGAGCTCGAGGGATATGTGCGCGAAGCGATTCGCTTGGATCCTGTCACTGTTGGCGTCATGC
GTGAGTC
ACTACTTGACTTTTTCGTCACCTAGTCTGACGGGGAACCCAGGCGAGATTACGACGGGTACTTTATCTCAGGCCAGTGGGCAACCATTGCAAGCCAACGAGCGCATATTTGTCAGCTTGA
AGAAGGCCATGGTCAAC
GTGAGTGCAGATGCGAAGTCAAGGGTCGTGCAGCGCTGACTCTAAGCAGGAGGACCTCTACCCTCATCCCAAGTCCGTTGATCTCCATAGGTCCAAGGAGCAA
AAACTTCTGCTGGGTGACGGAACCTCCAAGCTGCTCGGCGAGGATTATATCCTCGACGTCGGTGCTCACGTCCTCAAGGCCGTCTTCAGTCTCAAGAACCTCCGCCGTGCGCCCGGACCG
TCTGGAACACTTCGTCGATATGTCCAAGATCACAATGGTACGAAGCAGTACTTCTATCTCGACCAAAAGCAAAAGATCAGCCCATGGCCTACGTCCATGTTACTCCAG
GTATGCCACTAC
CTCTCATAGGGAATTGATGTTCTAACACGACAACAGTACGACCAAGTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGGTGACCCCGCCTTCACCAACCCCGACCGTGACCTCGCGCGTCGGAGAGGTCCTCTACGCGACTCTGAACGACTCGTTTGACACTGCCATTCATGCTGTCGACGAGATTTATACC
GCAAACGCTACCATGCCCGGCGCCAGAGACGTGGATGAAGATTACGACAATGGTCCCCAAAGTCCTATTGCAAAGAGCTTGTATGGCGCCAAAAACGAA
CTCAACAGGTGGCGGGGCAAA
AGTCCCCCTCTCCCAAGCTTCGAAATCGTCAGTGGACTCGTCGACGCAGGCCTCAACAAGGGTAGCATAGATGACCGGAAACTCTTG
CTCGAAGCTGCCCTGTCAACAATGTCTTCGCTC
CCCAAAGGTGCTCTCTCAGATACGCTTAACAGAAAGACGGTCGCCCTTCTCTATCGTGATTTACCTCACCCGCCGCCGACGTTTATAAACAACCAATACGCATGGCGACAACCCGATGGT
TCGCACAACAATCCGGCGAACCCCGACCTCGGCAAGGCAGGGATGCCCTATGCACGCAACGTGCAGTCCCATACCCCAATGCCCATGAGCGAGCAGCCCGATCCTGGCCTCATCTTCGAT
TCGCTCCTCAGGAGGGACCGTTTCAGGCCCCATCCAGCCGGCAACTCTGCCCTTCTTTTCGGTTTCGCGACGCTTGTCATTCATACTTGCTTCCGCACCAATCACGGTGACTGGACGATC
AACGATACCTCGTCCTACGTCGATCTCTCGCCACTCTACGGCAACTCCCTCGAGGGTCAGTTGAAGCTTCGTAGACAAGATGGTACCGGAAAGATGTGGAACGACGTCTTCGCCGAGGAT
AGGCTCCTTTTCCTCCCGCCTATCAGCTGTGCACTTCTCGTTCTCTTCTGCAGAAACCACAACTATATCGCCCAGAAGCTCCTCGAGATCAATGAGAAGGGTCGTTGGAAGTGCCCGCCA
CCCGACGATGAGCAGGCTCGCATGACCCAAGACGACGAAATCTTCAATATTGCCCGTCTCATCAATTGTGGACACTTTGCTGGCATTGTCTTCAGCGACTATCTTGCAGGCATTCTCGG
G
CTATCCCACGATGCTAATCCCTGGTCCCTGGATCCCTTCTCCGAGATTCGTAATGAGGACCACACCATTGTCGAGCG
TGGTTGCGGTAACGCGAACAGCGTCGAGTTCAACCTTCTCTAT
CGCTGGCACGCCACCCTTTCCGAGCCAGACGTCGCTTGGGTTGAGCGCATATTCGCGTCGAGCTTTGCTGGAAAGTCTGCCGAGGAAATCACCATCCGTGATTTCAACCAG
GTCACAGAA
AATCTTAGAGAGGCCTCTAGGAGAGACATCAAGACGTGGACGTTTGCTGGTCTGCACCGCGGGGAAGATGGGAAATTCCACGACTCTGATATTGCCAAAATCCTCATGGATGCCACCTCC
CACCCAGCAGGCGCGTTTGGTGCTCGCCATACACCAGGTATCATGCGCACGATTGAGATCATGACTATCCAAATGGCTCGAAAGTGGGGTGTATGCACGCTCAACGAGTTCAGGAAGAGT
CTTGGCTTGAAGC
CGTACACTACGTTCCAGGAGTGGAATCCAGATCCAGCCATCTGGATGCCCGCTCAGGCTCTCTATGAGCAAGTGGACAGGCTCGAGCTCTATGTCGGTCTTCAGGCA
GAGGATACTAAGAAGCCTGGGCCTGGTGCCGGTTTGTGCCCAGGATACACAATCTCTAGGGCTATTCTCGCGG
ATGCCATCGCGTTGACTCGTGGAGATCGATTCTACACTTACGATTTC
ACCCCATCGACCTATACTTCTTGGGGTTACAAGGATTGCCAGCGCGATCCCACGAACCCTGGTGCTGGATCTGTTCTTGGTCCGCTCTTCCTTCGCACGCTGCCGAACAACTACCGCCCA
GACTCCGTCTTCACGTGGTTCCCGATGCTTACCCCCGAAGCTACGCGAAAGAACCTCACCCGCCTTGGCAAGGCGGACAAGTATACTTTTGAGCGACCCGGAGAATTGAGCATGATCAAA
TCCGTCGAAGACGTCGGCGCAGTTATGGACTACACTACCGGTCGCGGATCAAGGGTTGTCAGGAGCGTGTATGGACCCAAGGCGCGCGAGATCATGGATGGTGGCGG
GTACTTTGTACTT
TTGGATGACGTCCGAGCAGACATGCACCGTCGCGCAATTCAGCAAGCCATTTTCCACAATGTCGAGCACACTGGTCCGATCGCCCGCGCAATCGAGTCCAAGATGCGTGCTCTTATTCAC
CACAAGAGTTTCGAGCTCGTCAAGGGCAAGACAAAATGCATCGACATTGTCAAGGACGTTGTCAACCTGGCACCCATTCATTGGATCGCCGACGCCCTC
GGTCTTCCTCTCAAGACACAT
GATCACATGAAGGGAACCATCTTCGAGCAGCAAGCTGATCAAATCTTCAAGGATATTTACTCGTACATCTTCCACGAGATTGACCCCTCGCTCTTGGTCAACTTCCGTGGGATTGTCAAG
AAGCATGTCAGCTTTATGATGCGCTACATCGAGCCTCAAGTACAGGATTCGAATGGC
ATCATCCCCAGCGTTGCGGCAATCAAGGACGCTATCGTTGGCATCTGGGTCGACCGTCGTGGA
GACTGCGGTCGCTTCTACGATTCCATGGTAGCCAATGGCTTCTCTAGGACCGACGTCATGAACGATGTGCTTGCGCTTGCCGTTCTGGCCACAGTCGAACTTTCTCACT
TGCTCGTTCAT
GTGATCAACTTCTATCTCGAAGAGGAGAACAAGGAATATCGTGATCGCATCACTGCCGCCGCCTTTGGCGACGAGACTGTCACAGCTGCAGAGCTCGAGGGATATGTGCGCGAAGCGATT
CGCTTGGATCCTGTCACTGTTGGCGTCATGC
GCGAGATTACGACGGGTACTTTATCTCAGGCCAGTGGGCAACCATTGCAAGCCAACGAGCGCATATTTGTCAGCTTGAAGAAGGCCATG
GTCAAC
GAGGACCTCTACCCTCATCCCAAGTCCGTTGATCTCCATAGGTCCAAGGAGCAAAAACTTCTGCTGGGTGACGGAACCTCCAAGCTGCTCGGCGAGGATTATATCCTCGACGTC
GGTGCTCACGTCCTCAAGGCCGTCTTCAGTCTCAAGAACCTCCGCCGTGCGCCCGGACCGTCTGGAACACTTCGTCGATATGTCCAAGATCACAATGGTACGAAGCAGTACTTCTATCTC
GACCAAAAGCAAAAGATCAGCCCATGGCCTACGTCCATGTTACTCCAG
TACGACCAAGTTTGA

Retrieve as FASTA