Entry information : SreLDS
Entry ID 10736
Creation 2012-03-09 (Christophe Dunand)
Last sequence changes 2012-03-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-09 (Christophe Dunand)
Peroxidase information: SreLDS
Name SreLDS
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Ustilaginomycetes Ustilaginaceae Sporisorium
Organism Sporisorium reilianum    [TaxId: 72558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SreLDS
start..stop
S start..stop
UmLDS01 1948 0 12..1074 1..1063
SrosLDS01 568 0 93..1029 3..984
GluxLDS02 522 2e-168 95..757 76..759
SrosLDS02 511 1e-165 94..679 2..590
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 212763..212795 33 N° 2 212909..216100 3192  
join(212763..212795,212909..216100)


exon

Literature and cross-references SreLDS
Protein ref. UniGene:   .E6ZP36
DNA ref. GenBank:   FQ311434.1 (212763..216100)
Protein sequence: SreLDS
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1074
PWM (Da):   %s   118811.98  
PI (pH):   %s   5.84
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATMTTETMEQVKTFVKDKVNQTTDAAGLSATETRKKAQAAVKQAKQKTSAATTTSIESLQMLLDQLNRSRIVNDVKLLGQAPNLLITGLTGGGLDDRKLLLEQLITLLASMPVTSNISRTLSDALIGIIWGDLPHPAVSFLGPEHRFRRPDGSDNNIMNPKLGASNQPYSRNVQRTHPQQVNLPDPGTVYDLLLARDSFEPHPTGISSLLFNFANIIIHDIFSTTRQPGAHSAYNEHSSYLDLQVVYGADLEEQTRVRTGTLGLLKPDAIGDWRLAMMPPATAALGVLFSRNHNFIAKRLYEVNENKRFDDLEGEALDEELFGIARLVNCGHFLHIILRDYIPVILNTNDSEWYVDPLNVIKSIGGPGSLERGIGNSVAAEFSVLYRWHAAVSQNDEKWMNEFLEAQFPGKSPDEVSPMEFVAAAAALKHDFLDTDPGEWNLHSWERDAQGKFDDALIAQVVKDTVSDVAAAFRARGHPSWFRPIEILGMITARKDWALCTMNEFRHFLGLKTYNSFSEWNPDPKISRAAEMLYGDIDNLELYPGLMAEEAKPSIPGSGLCPGYTISRGILSDAAALTRGDRFYTNDFSTSNLTSAGYEYCTTPQPGGHGLMGKLIMANLPGQFPYNSVYALFPFRIPERTVTMLKEKHVLEQYDTSYPAPPRRWYAIESYAASKEILEDSRYFVALPPMSYDESLMTSALHSIPRFHDEVADFYSVNTGLIMKDRSIPYSPSGRERIVDLIEVVNTVSAQFTAKLFALPTPGSHGLHLGMSPEELSTTLAKPLAYAMYGSFDFQGHQTWNLEEESEACTRRLKKLIWARIHTVDGILSPVFSIVQGISNVVGGPRNIAANEMAKHFYHTLFASGKSNDELVKDCLHMMVSLTATHALVLVQTFKWFLEEENAEHLSAMYTLAQKNDPASNAELRNRLMEAYRLSSITPPQAKFALQSVALPDVDDGKVHVQVGDGVYISPSALYRDPQLSSDPERFAPSSKKPVRLGLGDAPTQSLLEVALPAMAKQFFKHSNLRMAASGPPPVVNDAGPTANEKLPYFVSNHGAEYPLPIDTAMHVIYEAR*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 13, 1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGACGATGACCACTGAGACGATGGAGCAGGTACGTCTGGACGAAACCCTTCCTCTCCTGTTCTTTCAGCCTCCTCATTGCTGTTGTCTGACCACATATCCTTCTTGCTTTCCATCT
TCGACCCGCTCTTTCGCTTCTCTCAGGTCAAGACCTTTGTCAAGGACAAGGTGAACCAGACCACCGATGCTGCCGGTCTCTCCGCCACCGAGACGCGCAAAAAGGCACAGGCCGCGGTGA
AGCAGGCAAAGCAAAAGACGTCGGCGGCCACCACCACCTCGATCGAGTCGCTGCAGATGCTGCTGGACCAGCTCAACCGCAGCCGAATCGTCAACGATGTCAAGCTGCTCGGTCAAGCAC
CCAACCTGCTCATCACGGGCCTCACGGGCGGAGGCTTGGACGATCGCAAGCTTTTGCTCGAGCAGCTCATCACGCTGCTCGCCAGCATGCCCGTCACGTCCAACATCAGCCGTACGCTCT
CCGACGCCCTGATCGGCATCATCTGGGGTGATCTTCCGCATCCTGCCGTCTCGTTCCTGGGTCCCGAGCACCGCTTCCGACGCCCCGATGGCTCGGACAACAATATCATGAACCCCAAGC
TCGGTGCCTCGAACCAGCCCTACTCTCGCAACGTGCAGCGCACGCATCCACAGCAGGTCAACCTTCCCGACCCGGGCACGGTCTACGACCTGTTGCTTGCGCGAGACAGCTTCGAGCCGC
ACCCTACCGGCATCAGCTCGCTGCTTTTCAACTTTGCCAACATCATCATCCACGACATCTTCTCCACCACGCGTCAGCCCGGCGCCCACTCTGCCTACAACGAGCATTCGTCGTACCTCG
ATCTGCAGGTCGTCTACGGCGCCGACCTCGAAGAGCAGACGCGCGTGCGAACGGGCACGCTCGGTCTGCTGAAGCCCGACGCCATCGGCGACTGGCGTCTGGCCATGATGCCGCCCGCGA
CGGCTGCGCTCGGCGTGCTCTTCAGCCGCAACCACAACTTCATCGCCAAGCGTCTGTACGAGGTCAACGAGAACAAGCGCTTCGACGACCTCGAGGGCGAGGCGCTCGACGAGGAGCTCT
TTGGCATTGCGCGTCTCGTCAACTGCGGTCACTTCTTGCACATCATCCTGCGCGACTACATCCCCGTCATCCTCAACACGAACGACTCGGAGTGGTACGTCGACCCTCTGAACGTGATCA
AGAGCATCGGCGGTCCCGGAAGCCTCGAGCGTGGCATTGGCAACTCGGTCGCGGCCGAGTTCTCGGTGCTCTACCGTTGGCACGCAGCCGTGTCGCAGAACGACGAAAAGTGGATGAACG
AGTTCCTCGAGGCCCAGTTTCCAGGCAAGAGCCCCGACGAGGTCTCTCCCATGGAGTTTGTCGCAGCAGCAGCAGCGCTCAAGCACGACTTCCTCGACACGGATCCAGGCGAGTGGAACC
TCCACAGCTGGGAGAGAGATGCGCAGGGCAAGTTTGACGACGCGCTGATTGCCCAGGTCGTCAAGGATACCGTCTCGGACGTGGCTGCCGCCTTCCGCGCCCGCGGCCACCCGAGCTGGT
TCCGCCCCATCGAGATCCTCGGCATGATCACGGCCCGCAAGGACTGGGCGCTCTGCACCATGAACGAGTTCCGCCACTTCCTCGGCCTCAAGACGTACAACTCGTTCAGCGAGTGGAACC
CCGATCCCAAGATCTCCAGGGCAGCCGAGATGCTCTACGGCGACATTGACAACCTCGAGCTCTACCCGGGCCTCATGGCCGAAGAGGCCAAGCCCAGCATCCCCGGCAGCGGTCTCTGCC
CCGGCTACACGATCTCGCGCGGTATCCTCAGCGACGCGGCCGCGCTCACCCGAGGCGACCGCTTCTACACCAACGACTTCTCCACGTCGAACCTGACGAGCGCCGGCTACGAATACTGCA
CCACACCGCAGCCCGGCGGACACGGTCTGATGGGCAAGCTCATCATGGCCAACCTGCCCGGACAGTTCCCCTACAACTCGGTCTACGCGCTGTTCCCCTTCCGCATTCCCGAGAGGACGG
TCACCATGCTCAAGGAGAAGCACGTGCTCGAGCAGTATGACACGTCTTATCCGGCGCCTCCCCGTCGCTGGTATGCGATCGAGTCGTACGCGGCTAGCAAGGAGATCCTCGAGGACAGCC
GCTACTTTGTCGCGCTGCCGCCCATGTCGTACGACGAGAGCCTCATGACCTCTGCGCTCCACTCGATTCCGCGCTTCCACGACGAGGTGGCCGACTTCTACAGCGTCAACACCGGCTTGA
TCATGAAGGACCGAAGCATCCCTTACTCGCCTTCGGGTCGCGAGAGGATCGTGGATCTCATCGAGGTGGTCAACACGGTCTCGGCTCAGTTCACGGCCAAGCTCTTTGCGCTGCCCACAC
CCGGCAGTCACGGCCTTCACCTCGGTATGTCGCCCGAAGAGCTGTCCACGACGCTCGCCAAGCCGCTCGCCTACGCCATGTACGGCTCGTTTGACTTCCAGGGTCACCAGACGTGGAACC
TCGAGGAGGAGTCCGAGGCATGCACGCGTCGTCTCAAGAAACTCATCTGGGCTCGCATCCATACGGTCGACGGCATCTTGTCGCCCGTCTTTTCGATTGTGCAGGGCATCTCGAACGTCG
TTGGCGGACCGCGCAACATTGCTGCCAACGAGATGGCCAAGCACTTCTACCACACGCTGTTTGCCTCGGGCAAGAGCAACGACGAGCTCGTTAAGGACTGCCTGCACATGATGGTGTCTC
TCACGGCGACCCACGCGCTGGTGCTGGTGCAGACGTTCAAGTGGTTCCTGGAAGAGGAGAATGCTGAGCACCTCTCTGCCATGTACACGCTGGCGCAGAAGAACGACCCTGCCTCGAACG
CCGAGCTGCGCAACCGCCTCATGGAGGCCTACCGTCTCAGCAGCATCACGCCGCCGCAAGCCAAGTTTGCGCTCCAGTCGGTGGCCCTGCCCGACGTCGACGACGGCAAAGTGCACGTGC
AGGTGGGCGACGGCGTCTACATCTCGCCCTCGGCTCTGTACCGCGATCCACAGCTCTCGAGCGATCCCGAGCGCTTCGCTCCCAGCAGCAAGAAGCCTGTCCGCCTCGGTCTCGGCGATG
CCCCTACTCAGTCGCTCCTCGAGGTGGCTCTTCCGGCCATGGCCAAGCAGTTTTTCAAGCATTCGAACCTTCGCATGGCTGCTTCTGGCCCTCCTCCTGTGGTCAACGACGCTGGTCCCA
CGGCCAACGAGAAGCTGCCCTACTTTGTCAGCAACCACGGAGCCGAGTATCCGCTTCCGATCGACACGGCGATGCACGTCATCTACGAGGCTCGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGACGATGACCACTGAGACGATGGAGCAGGTCAAGACCTTTGTCAAGGACAAGGTGAACCAGACCACCGATGCTGCCGGTCTCTCCGCCACCGAGACGCGCAAAAAGGCACAGGCC
GCGGTGAAGCAGGCAAAGCAAAAGACGTCGGCGGCCACCACCACCTCGATCGAGTCGCTGCAGATGCTGCTGGACCAGCTCAACCGCAGCCGAATCGTCAACGATGTCAAGCTGCTCGGT
CAAGCACCCAACCTGCTCATCACGGGCCTCACGGGCGGAGGCTTGGACGATCGCAAGCTTTTGCTCGAGCAGCTCATCACGCTGCTCGCCAGCATGCCCGTCACGTCCAACATCAGCCGT
ACGCTCTCCGACGCCCTGATCGGCATCATCTGGGGTGATCTTCCGCATCCTGCCGTCTCGTTCCTGGGTCCCGAGCACCGCTTCCGACGCCCCGATGGCTCGGACAACAATATCATGAAC
CCCAAGCTCGGTGCCTCGAACCAGCCCTACTCTCGCAACGTGCAGCGCACGCATCCACAGCAGGTCAACCTTCCCGACCCGGGCACGGTCTACGACCTGTTGCTTGCGCGAGACAGCTTC
GAGCCGCACCCTACCGGCATCAGCTCGCTGCTTTTCAACTTTGCCAACATCATCATCCACGACATCTTCTCCACCACGCGTCAGCCCGGCGCCCACTCTGCCTACAACGAGCATTCGTCG
TACCTCGATCTGCAGGTCGTCTACGGCGCCGACCTCGAAGAGCAGACGCGCGTGCGAACGGGCACGCTCGGTCTGCTGAAGCCCGACGCCATCGGCGACTGGCGTCTGGCCATGATGCCG
CCCGCGACGGCTGCGCTCGGCGTGCTCTTCAGCCGCAACCACAACTTCATCGCCAAGCGTCTGTACGAGGTCAACGAGAACAAGCGCTTCGACGACCTCGAGGGCGAGGCGCTCGACGAG
GAGCTCTTTGGCATTGCGCGTCTCGTCAACTGCGGTCACTTCTTGCACATCATCCTGCGCGACTACATCCCCGTCATCCTCAACACGAACGACTCGGAGTGGTACGTCGACCCTCTGAAC
GTGATCAAGAGCATCGGCGGTCCCGGAAGCCTCGAGCGTGGCATTGGCAACTCGGTCGCGGCCGAGTTCTCGGTGCTCTACCGTTGGCACGCAGCCGTGTCGCAGAACGACGAAAAGTGG
ATGAACGAGTTCCTCGAGGCCCAGTTTCCAGGCAAGAGCCCCGACGAGGTCTCTCCCATGGAGTTTGTCGCAGCAGCAGCAGCGCTCAAGCACGACTTCCTCGACACGGATCCAGGCGAG
TGGAACCTCCACAGCTGGGAGAGAGATGCGCAGGGCAAGTTTGACGACGCGCTGATTGCCCAGGTCGTCAAGGATACCGTCTCGGACGTGGCTGCCGCCTTCCGCGCCCGCGGCCACCCG
AGCTGGTTCCGCCCCATCGAGATCCTCGGCATGATCACGGCCCGCAAGGACTGGGCGCTCTGCACCATGAACGAGTTCCGCCACTTCCTCGGCCTCAAGACGTACAACTCGTTCAGCGAG
TGGAACCCCGATCCCAAGATCTCCAGGGCAGCCGAGATGCTCTACGGCGACATTGACAACCTCGAGCTCTACCCGGGCCTCATGGCCGAAGAGGCCAAGCCCAGCATCCCCGGCAGCGGT
CTCTGCCCCGGCTACACGATCTCGCGCGGTATCCTCAGCGACGCGGCCGCGCTCACCCGAGGCGACCGCTTCTACACCAACGACTTCTCCACGTCGAACCTGACGAGCGCCGGCTACGAA
TACTGCACCACACCGCAGCCCGGCGGACACGGTCTGATGGGCAAGCTCATCATGGCCAACCTGCCCGGACAGTTCCCCTACAACTCGGTCTACGCGCTGTTCCCCTTCCGCATTCCCGAG
AGGACGGTCACCATGCTCAAGGAGAAGCACGTGCTCGAGCAGTATGACACGTCTTATCCGGCGCCTCCCCGTCGCTGGTATGCGATCGAGTCGTACGCGGCTAGCAAGGAGATCCTCGAG
GACAGCCGCTACTTTGTCGCGCTGCCGCCCATGTCGTACGACGAGAGCCTCATGACCTCTGCGCTCCACTCGATTCCGCGCTTCCACGACGAGGTGGCCGACTTCTACAGCGTCAACACC
GGCTTGATCATGAAGGACCGAAGCATCCCTTACTCGCCTTCGGGTCGCGAGAGGATCGTGGATCTCATCGAGGTGGTCAACACGGTCTCGGCTCAGTTCACGGCCAAGCTCTTTGCGCTG
CCCACACCCGGCAGTCACGGCCTTCACCTCGGTATGTCGCCCGAAGAGCTGTCCACGACGCTCGCCAAGCCGCTCGCCTACGCCATGTACGGCTCGTTTGACTTCCAGGGTCACCAGACG
TGGAACCTCGAGGAGGAGTCCGAGGCATGCACGCGTCGTCTCAAGAAACTCATCTGGGCTCGCATCCATACGGTCGACGGCATCTTGTCGCCCGTCTTTTCGATTGTGCAGGGCATCTCG
AACGTCGTTGGCGGACCGCGCAACATTGCTGCCAACGAGATGGCCAAGCACTTCTACCACACGCTGTTTGCCTCGGGCAAGAGCAACGACGAGCTCGTTAAGGACTGCCTGCACATGATG
GTGTCTCTCACGGCGACCCACGCGCTGGTGCTGGTGCAGACGTTCAAGTGGTTCCTGGAAGAGGAGAATGCTGAGCACCTCTCTGCCATGTACACGCTGGCGCAGAAGAACGACCCTGCC
TCGAACGCCGAGCTGCGCAACCGCCTCATGGAGGCCTACCGTCTCAGCAGCATCACGCCGCCGCAAGCCAAGTTTGCGCTCCAGTCGGTGGCCCTGCCCGACGTCGACGACGGCAAAGTG
CACGTGCAGGTGGGCGACGGCGTCTACATCTCGCCCTCGGCTCTGTACCGCGATCCACAGCTCTCGAGCGATCCCGAGCGCTTCGCTCCCAGCAGCAAGAAGCCTGTCCGCCTCGGTCTC
GGCGATGCCCCTACTCAGTCGCTCCTCGAGGTGGCTCTTCCGGCCATGGCCAAGCAGTTTTTCAAGCATTCGAACCTTCGCATGGCTGCTTCTGGCCCTCCTCCTGTGGTCAACGACGCT
GGTCCCACGGCCAACGAGAAGCTGCCCTACTTTGTCAGCAACCACGGAGCCGAGTATCCGCTTCCGATCGACACGGCGATGCACGTCATCTACGAGGCTCGTTGA

Retrieve as FASTA