Entry information : SpopPGHS
Entry ID 10737
Creation 2012-03-12 (Christophe Dunand)
Last sequence changes 2012-03-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: SpopPGHS
Name SpopPGHS
Class H synthase    [Orthogroup: PGHS001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Mycosphaerellaceae Mycosphaerella
Organism Septoria populicola (Mycosphaerella populicola)    [TaxId: 215467 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SpopPGHS
start..stop
S start..stop
MpopPGHS 1272 0 1..628 1..628
AtePGHS01 878 0 1..620 1..616
HpulPGHS 868 0 1..626 1..624
NcPGHS01 861 0 3..625 31..651
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8167..8661 495 N° 2 7721..8118 398 N° 3 7606..7666 61 N° 4 7480..7544 65
N° 5 7248..7408 161 N° 6 6480..7186 707  
complement(join(6480..7186,7248..7408,7480..7544,7606..7666,7721..8118,8167..866 1))


exon

Literature and cross-references SpopPGHS
DNA ref. JGI genome:   scaffold_40 (8661..6480)
Cluster/Prediction ref. JGI gene:   47567
Protein sequence: SpopPGHS
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   629
PWM (Da):   %s   70525.54  
PI (pH):   %s   6.59
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MESPNFKPSLFDTIFIAIFHVVNLYIPWHRLPGLLGAFNLSFLRVELRQYNLHDGYASADHQGKLGDITGSDKRYIGTRNSDGTDNSLELRKMGCAGARFGRSFNRKYCEKPTDDELWNPSPREVSLAFMAREPQDFKPATTLNLLAAAWIQFQVHDWFNHEDVSNDVAYDIPLRKSDPWPADHMKLFQTKPDTVLDPSDELCPGYRNVNTAWWDGSQIYGSSESVTLYLRNNRPHGKLVLERIGTEDRFLPRDSDGTPKVGFSDNWWLGVELLHTLFALEHNAICDKIQQAHPEWTGGQVFDKARIANCALMAKIHTVEWTPAILAHPALQIGMHANWGIVGEQLTKAVGRVSKTSEDISGIPGSGVDHHGIPYSLTEEFVSVYRMHSLIDNIALFGAVSGKHISTIPTEDVIFHKSLDAIKAGASFADAFYSFGINYPGAITNNNYPKVLQHLPTPDGQLRDMGAVDILRDRERGVPRYTVFRRLLRMSVPKTFEELTGGNKELAIKLSKVYGGDIDKVDTLVGSHSEPLVEGFGFSDTAFRIFIVMASRRLKSDRFIAGAWNAEMYTREGFDWVQNTTMSDVLGRHFPELTALLPKKTNVFAPWDKLPESKAYPGMETNAPLS

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTCTCCAAATTTCAAACCGTCCTTGTTCGACACCATCTTCATCGCCATATTCCATGTCGTCAATCTTTACATCCCCTGGCATCGTCTCCCTGGTCTTCTCGGGGCGTTCAATCTT
AGTTTCCTCCGAGTCGAGTTGAGACAATACAATCTCCATGATGGGTACGCATCCGCAGATCATCAAGGAAAGCTCGGAGACATCACCGGATCGGACAAGCGATATATCGGTACTCGAAAT
TCAGATGGTACAGATAACTCCCTCGAGCTGCGGAAGATGGGATGTGCTGGCGCGAGATTTGGCCGTAGCTTCAATCGCAAGTATTGTGAGAAGCCGACAGATGATGAGTTGTGGAACCCA
AGTCCCAGGGAAGTCAGCCTGGCCTTCATGGCGAGAGAGCCGCAAGATTTCAAACCAGCGACTACACTGAACCTTCTCGCGGCTGCGTGGATCCAGTTTCAAGTCCATGATTGGTTCAAT
CATGAAGACGTAAGT
GTACTTACTACTCATGCTGCACAGGAATCATCAAGTTAACGGGCGTAGAACGATGTAGCATACGATATTCCGCTTCGAAAAAGTGATCCGTGGCCGGCAGACCAT
ATGAAGCTGTTCCAGACCAAGCCAGACACCGTCTTGGACCCCTCCGACGAGCTCTGTCCTGGCTACCGCAACGTCAACACTGCTTGGTGGGATGGCTCACAGATTTATGGCTCAAGCGAG
AGCGTCACACTGTATTTGCGAAACAATCGTCCGCATGGCAAGCTCGTCCTGGAAAGGATTGGCACAGAGGATCGCTTCCTTCCACGCGATAGCGATGGCACGCCCAAGGTGGGCTTCAGT
GACAATTGGTGGCTCGGAGTGGAGTTGCTACACACGCTCTTCGCCCTCGAGCACAACGCAATCTGTGACAAAATCCAACAGGCGCATCCCGAATGGACAGG
GCGAGTACAGTGATTGCAT
AGATGCGTCCGGAGGCGCAGGCTGACATTATGCAGTGGCCAGGTCTTTGACAAGGCACGGATCGCCAACTGTGCGCTCATGGCCAAAATTCATACGGTACGTCTTTTGCTCCTCATGGCC
GACTGCTGTTTCCTCGACTCTGACCGATACTGTACAGGTCGAGTGGACTCCCGCCATTCTAGCTCATCCTGCGCTTCAGATCGGAATGCACGCCAATTGGTGGTCAGTATGCACCAGAAA
TGATCCATGCTGCATCTGGAAAATACACACTGACTGTGGGCGCTGAAATCCAGGGGTATTGTTGGCGAGCAGCTTACCAAAGCAGTGGGCCGTGTCTCGAAAACAAGTGAAGACATTAGC
GGCATTCCAGGCTCGGGTGTAGACCACCACGGCATCCCCTATTCCCTGACAGAAGAATTCGTCTCGGTGTATCGCATGCATTCTCTGATCCCAG
GTAAGTCCACCGTTCCAGCCTGTACA
CGCCTCGAGCTCGAGCTCAAGCTCATGGTAGTCAGACAACATTGCGCTCTTCGGCGCAGTCAGTGGCAAGCACATTAGCACGATTCCTACAGAAGACGTGATCTTCCACAAATCTCTCGA
TGCCATCAAAGCCGGCGCTAGCTTTGCCGATGCGTTCTACTCTTTCGGCATCAACTACCCTGGCGCCATTACCAACAACAATTATCCCAAGGTACTGCAACATCTTCCCACACCCGATGG
CCAGCTCCGAGATATGGGCGCAGTAGATATCCTACGCGACCGCGAGCGTGGCGTCCCACGATACACCGTTTTTCGGCGTTTGCTTCGTATGTCTGTTCCCAAGACGTTCGAGGAGCTGAC
TGGCGGCAACAAAGAGCTTGCCATCAAGCTGAGCAAGGTCTACGGGGGAGACATTGACAAAGTCGATACCTTGGTCGGCTCTCATAGCGAGCCTCTTGTGGAAGGCTTCGGTTTCAGCGA
CACAGCGTTCCGCATATTCATCGTCATGGCGAGTAGGCGCCTCAAGAGCGATCGCTTCATTGCCGGTGCTTGGAACGCTGAAATGTACACACGGGAAGGCTTCGACTGGGTGCAGAACAC
TACCATGAGCGATGTACTGGGTCGTCATTTCCCAGAGTTGACAGCACTTTTGCCCAAGAAGACCAACGTCTTCGCCCCATGGGACAAGTTGCCAGAGTCCAAGGCATACCCAGGGATGGA
GACGAACGCGCCTCTATCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTCTCCAAATTTCAAACCGTCCTTGTTCGACACCATCTTCATCGCCATATTCCATGTCGTCAATCTTTACATCCCCTGGCATCGTCTCCCTGGTCTTCTCGGGGCGTTCAATCTT
AGTTTCCTCCGAGTCGAGTTGAGACAATACAATCTCCATGATGGGTACGCATCCGCAGATCATCAAGGAAAGCTCGGAGACATCACCGGATCGGACAAGCGATATATCGGTACTCGAAAT
TCAGATGGTACAGATAACTCCCTCGAGCTGCGGAAGATGGGATGTGCTGGCGCGAGATTTGGCCGTAGCTTCAATCGCAAGTATTGTGAGAAGCCGACAGATGATGAGTTGTGGAACCCA
AGTCCCAGGGAAGTCAGCCTGGCCTTCATGGCGAGAGAGCCGCAAGATTTCAAACCAGCGACTACACTGAACCTTCTCGCGGCTGCGTGGATCCAGTTTCAAGTCCATGATTGGTTCAAT
CATGAAGACGTAAGT
AACGATGTAGCATACGATATTCCGCTTCGAAAAAGTGATCCGTGGCCGGCAGACCATATGAAGCTGTTCCAGACCAAGCCAGACACCGTCTTGGACCCCTCCGAC
GAGCTCTGTCCTGGCTACCGCAACGTCAACACTGCTTGGTGGGATGGCTCACAGATTTATGGCTCAAGCGAGAGCGTCACACTGTATTTGCGAAACAATCGTCCGCATGGCAAGCTCGTC
CTGGAAAGGATTGGCACAGAGGATCGCTTCCTTCCACGCGATAGCGATGGCACGCCCAAGGTGGGCTTCAGTGACAATTGGTGGCTCGGAGTGGAGTTGCTACACACGCTCTTCGCCCTC
GAGCACAACGCAATCTGTGACAAAATCCAACAGGCGCATCCCGAATGGACAGG
TGGCCAGGTCTTTGACAAGGCACGGATCGCCAACTGTGCGCTCATGGCCAAAATTCATACGGTCGAG
TGGACTCCCGCCATTCTAGCTCATCCTGCGCTTCAGATCGGAATGCACGCCAATTGGTG
GGGTATTGTTGGCGAGCAGCTTACCAAAGCAGTGGGCCGTGTCTCGAAAACAAGTGAAGAC
ATTAGCGGCATTCCAGGCTCGGGTGTAGACCACCACGGCATCCCCTATTCCCTGACAGAAGAATTCGTCTCGGTGTATCGCATGCATTCTCTGATCCCAG
ACAACATTGCGCTCTTCGGC
GCAGTCAGTGGCAAGCACATTAGCACGATTCCTACAGAAGACGTGATCTTCCACAAATCTCTCGATGCCATCAAAGCCGGCGCTAGCTTTGCCGATGCGTTCTACTCTTTCGGCATCAAC
TACCCTGGCGCCATTACCAACAACAATTATCCCAAGGTACTGCAACATCTTCCCACACCCGATGGCCAGCTCCGAGATATGGGCGCAGTAGATATCCTACGCGACCGCGAGCGTGGCGTC
CCACGATACACCGTTTTTCGGCGTTTGCTTCGTATGTCTGTTCCCAAGACGTTCGAGGAGCTGACTGGCGGCAACAAAGAGCTTGCCATCAAGCTGAGCAAGGTCTACGGGGGAGACATT
GACAAAGTCGATACCTTGGTCGGCTCTCATAGCGAGCCTCTTGTGGAAGGCTTCGGTTTCAGCGACACAGCGTTCCGCATATTCATCGTCATGGCGAGTAGGCGCCTCAAGAGCGATCGC
TTCATTGCCGGTGCTTGGAACGCTGAAATGTACACACGGGAAGGCTTCGACTGGGTGCAGAACACTACCATGAGCGATGTACTGGGTCGTCATTTCCCAGAGTTGACAGCACTTTTGCCC
AAGAAGACCAACGTCTTCGCCCCATGGGACAAGTTGCCAGAGTCCAAGGCATACCCAGGGATGGAGACGAACGCGCCTCTATCGTAG

Retrieve as FASTA