Entry information : MpopPGHS
Entry ID 10738
Creation 2012-03-12 (Christophe Dunand)
Last sequence changes 2012-03-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-27 (Catherine Mathe (Scipio))
Peroxidase information: MpopPGHS
Name MpopPGHS
Class H synthase    [Orthogroup: PGHS001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Mycosphaerellaceae Mycosphaerella
Organism Mycosphaerella populorum (Septoria musiva)    [TaxId: 85929 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MpopPGHS
start..stop
S start..stop
SpopPGHS 1272 0 1..628 1..628
AtePGHS01 884 0 1..620 1..616
HpulPGHS 877 0 1..628 1..626
NcPGHS01 870 0 4..625 32..651
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1438037..1438531 495 N° 2 1437595..1437992 398 N° 3 1437480..1437540 61 N° 4 1437355..1437419 65
N° 5 1437123..1437283 161 N° 6 1436355..1437061 707  
complement(join(1436355..1437061,1437123..1437283,1437355..1437419,1437480..1437 540,1437595..1437992,1438037..1438531))


exon

Literature and cross-references MpopPGHS
DNA ref. JGI genome:   scaffold_3 (1438531..1436355)
Cluster/Prediction ref. JGI gene:   62816
Protein sequence: MpopPGHS
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   629
PWM (Da):   %s   70614.64  
PI (pH):   %s   6.77
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MESPNFKPSLFDTIFIAIFHVVNLYIPWHRLPGLIGAFNLSFLRVELRQYNLHDGYASADHQGKLGDITGLNKRYIGTRNSDGTDNSLELRKMGCAGMRFGRSFNRKYCQKPTEDELWNPSPREVSLAFMAREPQDFKPATTLNLLAAAWIQFQVHDWFNHEDVSNDIAYDIPLRKSDPWPADHMKLFQTKPDTVLDPSDELCPGYRNANTAWWDGSQIYGSSESVTLSLRNNRPNGKLVLERVGTEDRFLPRDSDGTPKVGFSDNWWLGVELLHTLFALEHNAICDKIQQAHPEWTGGQVFDKARIVNCALMAKIHTVEWTPAILAHPALQIGMHANWGIVGEQLTKAVGRVSKTSEDISGIPGSGVDHHGIPYSLTEEFVSVYRMHSLIDNIALFGAVSGKHISTIPTEDVIFHKSLDAIKAGASFADAFYSFGINYPGAITNNNYPKVLQRLPTPDGQLRDMGTVDILRDRERGVPRYTAFRRLLRMSVPKTFEELTGGNKELAVKLSKVYGGDIDKVDTLVGSHSEPLVEGFGFSDTAFRIFIVMASRRLKSDRFIAGAWNAEMYTREGFDWVQNTTMSDVLERHFPELKALLPKKTNVFAPWDKLPESKAYPGMETNAPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTCTCCAAATTTCAAACCATCCTTGTTCGACACCATCTTCATTGCCATATTCCACGTCGTCAATCTTTACATCCCCTGGCATCGTCTCCCTGGCCTTATCGGGGCGTTCAATCTT
AGTTTCCTCCGAGTCGAGTTGAGACAATACAATCTCCATGATGGGTACGCATCCGCAGATCATCAAGGAAAGCTCGGAGACATCACCGGATTGAACAAGCGATATATCGGTACTCGAAAT
TCAGATGGTACAGATAACTCCCTCGAGCTGCGGAAGATGGGATGTGCTGGCATGAGATTTGGGCGTAGCTTCAATCGCAAGTATTGTCAGAAGCCGACAGAAGATGAGTTGTGGAACCCA
AGTCCCAGGGAAGTCAGCCTGGCCTTCATGGCGAGAGAGCCGCAAGATTTCAAACCAGCGACTACACTGAACCTTCTCGCGGCTGCGTGGATCCAGTTCCAAGTCCATGACTGGTTCAAT
CATGAAGACGTAAGT
GTACTACTCATTCTGCACAGGAATCATCAAGTTAACGGGCCTAGAACGATATAGCATACGATATCCCGCTTCGAAAAAGTGATCCGTGGCCGGCAGACCATATGA
AGCTGTTCCAGACTAAGCCAGACACCGTCTTGGACCCCTCCGACGAGCTCTGTCCTGGCTACCGCAACGCCAACACTGCTTGGTGGGACGGCTCACAGATTTATGGCTCAAGCGAGAGCG
TCACACTGTCTTTGCGAAACAATCGTCCGAATGGCAAGCTCGTCCTAGAAAGGGTTGGCACAGAGGATCGATTCCTTCCACGCGATAGCGATGGCACGCCCAAGGTGGGCTTCAGTGACA
ATTGGTGGCTCGGAGTGGAGTTGCTACACACGCTCTTTGCCCTCGAGCACAACGCAATCTGTGACAAAATCCAACAGGCGCATCCCGAGTGGACAGG
GTGAGTGCAGTGATTGCATACAT
GCGACCGGAGGTGCAGGCTGACATTATGCAGTGGCCAGGTCTTTGACAAGGCACGGATCGTCAATTGTGCGCTCATGGCCAAAATTCATACGGTATGACTTTTCTCCTCATGGCCGACTG
CTGTTTCCCCGACTCTGACCAATACTGTACAGGTCGAGTGGACTCCCGCCATTCTAGCTCATCCTGCGCTTCAGATCGGGATGCACGCCAATTGGTGGTTAGTATGCACCAGAAATGATC
CCTGCTGCACCTGGAACATCCTCACTGACTGTGGGCGCACAAATATAGGGGTATTGTTGGCGAGCAGCTTACCAAAGCAGTGGGCCGTGTCTCAAAAACCAGTGAAGACATTAGCGGCAT
TCCAGGCTCGGGTGTAGACCACCACGGCATCCCCTATTCCCTGACAGAAGAGTTCGTCTCGGTGTATCGCATGCATTCTCTGATCCCAG
GTAAGTCCACGGTTCCAGCCTGTATATGCCT
CGAGCTCGAGCTCAAGCTCATGGTAGTCAGACAACATCGCGCTCTTCGGCGCAGTCAGTGGCAAGCACATTAGCACGATTCCTACAGAAGATGTCATCTTTCACAAATCTCTCGATGCCA
TCAAAGCCGGCGCTAGCTTTGCCGATGCGTTCTACTCTTTCGGCATCAACTACCCTGGCGCCATTACCAACAACAATTATCCCAAGGTACTGCAACGTCTTCCCACACCCGATGGCCAGC
TCCGAGATATGGGCACAGTAGATATTCTACGCGATCGGGAGCGTGGCGTCCCACGATACACCGCTTTCCGGCGTTTGCTTCGTATGTCTGTTCCCAAGACGTTCGAGGAGCTGACTGGCG
GCAACAAAGAGCTTGCCGTCAAGCTGAGTAAGGTCTACGGGGGAGACATTGACAAAGTCGATACCTTGGTCGGCTCTCATAGCGAGCCTCTTGTGGAAGGCTTCGGTTTCAGCGACACAG
CGTTCCGCATATTCATCGTCATGGCGAGTAGGCGCCTCAAGAGCGATCGTTTCATTGCCGGTGCTTGGAACGCTGAAATGTACACACGGGAAGGTTTCGACTGGGTGCAGAACACTACCA
TGAGCGATGTACTGGAGCGTCATTTCCCAGAGTTGAAAGCGCTCTTGCCCAAGAAGACCAACGTCTTCGCCCCATGGGACAAGTTGCCAGAGTCCAAGGCATACCCGGGGATGGAGACGA
ACGCGCCTCCATCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTCTCCAAATTTCAAACCATCCTTGTTCGACACCATCTTCATTGCCATATTCCACGTCGTCAATCTTTACATCCCCTGGCATCGTCTCCCTGGCCTTATCGGGGCGTTCAATCTT
AGTTTCCTCCGAGTCGAGTTGAGACAATACAATCTCCATGATGGGTACGCATCCGCAGATCATCAAGGAAAGCTCGGAGACATCACCGGATTGAACAAGCGATATATCGGTACTCGAAAT
TCAGATGGTACAGATAACTCCCTCGAGCTGCGGAAGATGGGATGTGCTGGCATGAGATTTGGGCGTAGCTTCAATCGCAAGTATTGTCAGAAGCCGACAGAAGATGAGTTGTGGAACCCA
AGTCCCAGGGAAGTCAGCCTGGCCTTCATGGCGAGAGAGCCGCAAGATTTCAAACCAGCGACTACACTGAACCTTCTCGCGGCTGCGTGGATCCAGTTCCAAGTCCATGACTGGTTCAAT
CATGAAGACGTAAGT
AACGATATAGCATACGATATCCCGCTTCGAAAAAGTGATCCGTGGCCGGCAGACCATATGAAGCTGTTCCAGACTAAGCCAGACACCGTCTTGGACCCCTCCGAC
GAGCTCTGTCCTGGCTACCGCAACGCCAACACTGCTTGGTGGGACGGCTCACAGATTTATGGCTCAAGCGAGAGCGTCACACTGTCTTTGCGAAACAATCGTCCGAATGGCAAGCTCGTC
CTAGAAAGGGTTGGCACAGAGGATCGATTCCTTCCACGCGATAGCGATGGCACGCCCAAGGTGGGCTTCAGTGACAATTGGTGGCTCGGAGTGGAGTTGCTACACACGCTCTTTGCCCTC
GAGCACAACGCAATCTGTGACAAAATCCAACAGGCGCATCCCGAGTGGACAGG
TGGCCAGGTCTTTGACAAGGCACGGATCGTCAATTGTGCGCTCATGGCCAAAATTCATACGGTCGAG
TGGACTCCCGCCATTCTAGCTCATCCTGCGCTTCAGATCGGGATGCACGCCAATTGGTG
GGGTATTGTTGGCGAGCAGCTTACCAAAGCAGTGGGCCGTGTCTCAAAAACCAGTGAAGAC
ATTAGCGGCATTCCAGGCTCGGGTGTAGACCACCACGGCATCCCCTATTCCCTGACAGAAGAGTTCGTCTCGGTGTATCGCATGCATTCTCTGATCCCAG
ACAACATCGCGCTCTTCGGC
GCAGTCAGTGGCAAGCACATTAGCACGATTCCTACAGAAGATGTCATCTTTCACAAATCTCTCGATGCCATCAAAGCCGGCGCTAGCTTTGCCGATGCGTTCTACTCTTTCGGCATCAAC
TACCCTGGCGCCATTACCAACAACAATTATCCCAAGGTACTGCAACGTCTTCCCACACCCGATGGCCAGCTCCGAGATATGGGCACAGTAGATATTCTACGCGATCGGGAGCGTGGCGTC
CCACGATACACCGCTTTCCGGCGTTTGCTTCGTATGTCTGTTCCCAAGACGTTCGAGGAGCTGACTGGCGGCAACAAAGAGCTTGCCGTCAAGCTGAGTAAGGTCTACGGGGGAGACATT
GACAAAGTCGATACCTTGGTCGGCTCTCATAGCGAGCCTCTTGTGGAAGGCTTCGGTTTCAGCGACACAGCGTTCCGCATATTCATCGTCATGGCGAGTAGGCGCCTCAAGAGCGATCGT
TTCATTGCCGGTGCTTGGAACGCTGAAATGTACACACGGGAAGGTTTCGACTGGGTGCAGAACACTACCATGAGCGATGTACTGGAGCGTCATTTCCCAGAGTTGAAAGCGCTCTTGCCC
AAGAAGACCAACGTCTTCGCCCCATGGGACAAGTTGCCAGAGTCCAAGGCATACCCGGGGATGGAGACGAACGCGCCTCCATCGTAG

Retrieve as FASTA